ID: 915727772

View in Genome Browser
Species Human (GRCh38)
Location 1:158030912-158030934
Sequence CAGGATGAGCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915727772 Original CRISPR CAGGATGAGCAGATGGAGCT GGG (reversed) Intronic
901296144 1:8162197-8162219 AGGGATGTGCAGGTGGAGCTTGG - Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902837373 1:19055456-19055478 CAGGACCAGGAGATGGGGCTGGG + Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905912421 1:41663289-41663311 CAGGAGGAGACAATGGAGCTGGG + Intronic
906040676 1:42785713-42785735 CACGATGAGGAGATGGATCCTGG - Intronic
906771781 1:48491542-48491564 CAGGCTGAGCAGAAAGAGATAGG + Intergenic
912452287 1:109774434-109774456 CTGGATGAGCAAATGCAGCCTGG - Intronic
914788876 1:150858848-150858870 CAGGATGATCTCTTGGAGCTAGG - Intronic
915249414 1:154577727-154577749 CAGGAAGAGCTGGGGGAGCTGGG + Exonic
915348947 1:155212822-155212844 CAGATGGAGCAGCTGGAGCTGGG + Intronic
915352134 1:155233448-155233470 CAGATGGAGCAGCTGGAGCTGGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915865079 1:159490959-159490981 CATGATGGGCAGAATGAGCTTGG + Intergenic
915913902 1:159930102-159930124 CAAGATGAGAAGATAGAGTTTGG + Intronic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917509953 1:175661761-175661783 GAGGATGAGCAGATGTAGAGGGG - Intronic
918378391 1:183931568-183931590 AAGGAGGAGCAGATGGGACTGGG + Intronic
919059212 1:192609220-192609242 CAGTAGCAGCAGATGGTGCTTGG - Intergenic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
922813265 1:228430274-228430296 CAGAATGGGAAGATGGAACTTGG - Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1062813757 10:484400-484422 AAGGATGAGCTGATGGGTCTTGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063929119 10:11011389-11011411 AAGGATGGGCAGATGGAGGTGGG + Intronic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066456103 10:35573620-35573642 CAGGAGGAGCACTTGAAGCTGGG - Intergenic
1067587558 10:47484957-47484979 CAGGATGAGCGGGTGGATCCCGG - Intergenic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1072040684 10:91603395-91603417 CAGAATAAGCCTATGGAGCTGGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1075093544 10:119456625-119456647 CAGGAGGTGCAGCTGCAGCTAGG - Intronic
1075626400 10:123967140-123967162 GAGGAGGAGCCGCTGGAGCTGGG - Intergenic
1076230528 10:128816814-128816836 GAGGATGAAGAGAGGGAGCTGGG + Intergenic
1076330068 10:129657625-129657647 CTGGAGGAGGAGCTGGAGCTGGG + Intronic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1079256645 11:18836824-18836846 CAGGATGATCACATAGAGCCTGG - Intergenic
1080686428 11:34519218-34519240 AAGGATGTGAAGATGGAGCATGG + Intergenic
1081619333 11:44609752-44609774 GAGGAAGAGCAGCTGGAGCCTGG + Intronic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084469457 11:69348590-69348612 CAGGATGACCAGCTGCAGCTGGG - Intronic
1084670487 11:70603875-70603897 AATGCTGAGCAGATGGTGCTTGG + Intronic
1086212990 11:84343191-84343213 CAGGAAGAGAAGAGAGAGCTGGG + Intronic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1089559781 11:119338021-119338043 GAGGCTGTGCAGATGGGGCTGGG + Intergenic
1090888624 11:130902162-130902184 CAGAATGAGAAAATAGAGCTTGG - Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091443207 12:527572-527594 CTAGATGAGCAGATGGATATGGG - Intronic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1095996086 12:48085792-48085814 TAGGATGAGTGGATGCAGCTAGG + Intronic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1096477851 12:51919287-51919309 CAGAATGACCAGATGGCCCTGGG - Intronic
1096555089 12:52398924-52398946 CAGGCTGAGCAGCAGGTGCTAGG - Intronic
1097941793 12:65316937-65316959 GAGGATGAGAAGATGGGGGTAGG + Intronic
1098140350 12:67444479-67444501 CAGGTTGAACAAAAGGAGCTAGG + Intergenic
1099992269 12:89736589-89736611 AAGGATGAGAAGATGGGACTAGG + Intergenic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1102015233 12:109643919-109643941 CAGGAGGATCAGTTGGACCTGGG + Intergenic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103195675 12:119041881-119041903 CATGCTGAGAAGATTGAGCTCGG - Intronic
1104743295 12:131194365-131194387 GAGGGTGAGAAGATGGCGCTGGG + Intergenic
1104851584 12:131877814-131877836 CAGAATGAGAACATGGAGATTGG - Intergenic
1104874741 12:132026173-132026195 CAGGATGAGGAGTGGCAGCTCGG - Intronic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1105289712 13:19044645-19044667 AGGGATGAGCAGGTGGAGCACGG + Intergenic
1106550803 13:30769227-30769249 AAGGTGGAGCTGATGGAGCTTGG - Intergenic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110136229 13:72070753-72070775 CAGGACCATCAGCTGGAGCTTGG + Intergenic
1110395737 13:75027932-75027954 CATGCTGAGCAGATATAGCTAGG + Intergenic
1111759677 13:92445868-92445890 CAGGAGGATCAGTTGAAGCTAGG - Intronic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1112397985 13:99050946-99050968 CAGGATGAGCTGCTTGTGCTTGG - Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113045026 13:106146419-106146441 CAGAAAGAGCAGAAAGAGCTTGG - Intergenic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1117122905 14:52587840-52587862 AAGGATGGGAAGGTGGAGCTAGG + Intronic
1117761415 14:59032734-59032756 AAGGAAGAACAGTTGGAGCTGGG - Intergenic
1117810201 14:59537350-59537372 CAGGATGAAAATAGGGAGCTTGG - Intronic
1119388879 14:74276703-74276725 CAGAATGAGGAGATGGCGCTGGG - Intergenic
1119601187 14:75978443-75978465 GAGGCTGAGCAGACGGACCTGGG - Intronic
1120892536 14:89504101-89504123 CAGGATGAGCAAAGCTAGCTGGG - Intronic
1120993291 14:90397194-90397216 GAGGAAGAGCAGAGGGAGCGAGG - Exonic
1121697549 14:95926096-95926118 CAGGATGAGTAGAAAGTGCTTGG - Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122280453 14:100619298-100619320 CAGGAAGAGAAGCTGAAGCTGGG + Intergenic
1123005889 14:105323669-105323691 CAGGGTGTGCAGGTGGAGATGGG + Intronic
1126853015 15:52809770-52809792 TAGGAGGATGAGATGGAGCTGGG + Intergenic
1129297719 15:74609031-74609053 CAGGGAGAGCAGATGGTGTTGGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129377533 15:75143553-75143575 CAGAATGAGCAGATCCAGCCAGG + Intergenic
1129433672 15:75520362-75520384 CAGGATGAGCACTTTGATCTGGG - Intronic
1130255891 15:82325912-82325934 AGGGAGGAGCAGAGGGAGCTGGG + Intergenic
1130539293 15:84810449-84810471 CAGGATCAGCAGAAAGAACTGGG + Intergenic
1131444914 15:92490654-92490676 TAGGAGGAGAAGGTGGAGCTAGG - Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132887427 16:2188845-2188867 CAGGATGAGCTGCAGGGGCTGGG - Intronic
1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG + Intergenic
1133652113 16:7822327-7822349 AAGGAAGAGCAGAAAGAGCTGGG - Intergenic
1135074357 16:19380766-19380788 CAGAATGAGCACATGAGGCTGGG + Intergenic
1135621444 16:23959386-23959408 TAGGAAGATCAAATGGAGCTAGG - Intronic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1136394749 16:29986913-29986935 CTGGATGAGGAGTTTGAGCTTGG + Exonic
1136514572 16:30760427-30760449 CTGGCTGAGCTGCTGGAGCTAGG - Exonic
1137020393 16:35420022-35420044 CAGGCTGTGCAGATTGAGCAGGG + Intergenic
1137278213 16:46951571-46951593 CAGGATTAGCACATAAAGCTTGG + Intergenic
1138650644 16:58459062-58459084 GAAGATCAGCAGATGGAGATGGG - Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1140633293 16:76880941-76880963 GAGGATGAGCAATTGGGGCTGGG - Intergenic
1140661035 16:77191474-77191496 AGGGATGTGCAGATGGAGGTCGG + Exonic
1142263147 16:89051787-89051809 CAGGCTGGGCAGAAAGAGCTGGG - Intergenic
1142467506 17:144726-144748 CAGGCTGTGCAAATGGGGCTGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1148127228 17:45243086-45243108 CAGGGTGAGGAGGCGGAGCTGGG - Intronic
1148713546 17:49699378-49699400 GAGGAGGAGGAGCTGGAGCTTGG - Intergenic
1148884348 17:50760703-50760725 CAGGGTGAGCTGATGGTGCTAGG - Intergenic
1148887872 17:50786677-50786699 CAGCGGGAGCAGAGGGAGCTGGG + Intergenic
1149656401 17:58311683-58311705 CTGGATGTGCAGATCGAGCCTGG - Exonic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1150990418 17:70251466-70251488 AAGGAGGAGCAGCTGGAACTGGG + Intergenic
1151378712 17:73710098-73710120 CAAGGTCTGCAGATGGAGCTTGG - Intergenic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154355981 18:13623592-13623614 CACGATGACCAGAGGCAGCTCGG + Intronic
1154423328 18:14253043-14253065 GAGGAAAAGCAGATGGCGCTGGG + Intergenic
1154453544 18:14501248-14501270 CAGGAAAAGCAGATGGCACTGGG - Intergenic
1156233427 18:35177863-35177885 CAGTATGTGCAGATAGTGCTGGG - Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160939894 19:1615331-1615353 CAGGATGAGCAGTTTGGTCTGGG + Exonic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161153965 19:2722773-2722795 CAGGCTGAGAAGCTGGACCTTGG - Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161798551 19:6402121-6402143 GAGGATGAGGAGCTGGTGCTGGG + Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162924331 19:13922531-13922553 GAGGAGGAGCAGAGGGATCTGGG - Intronic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164323180 19:24168796-24168818 CAGGATCAGAACATGGAGATTGG - Intergenic
1164573713 19:29392779-29392801 TAAGATGAGCAGAGGGAGCTGGG + Intergenic
1164704788 19:30312279-30312301 CAGGATGAACAGAGGGGGCGGGG + Intronic
1164869823 19:31633412-31633434 GAGGGAGAGAAGATGGAGCTGGG + Intergenic
1165204707 19:34173303-34173325 GAGGATGAGCCGAGGGAGATGGG - Intronic
1166262118 19:41647612-41647634 CAGGAGGAGCACTTGAAGCTAGG - Intronic
1166299559 19:41906320-41906342 AAGGCTGAGCAGATGGGGTTCGG - Intronic
1166602428 19:44109417-44109439 CAGGAAGAGAAAATGGAGTTTGG + Exonic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1168108948 19:54181193-54181215 CAGGAGGAGGACAGGGAGCTTGG + Intronic
1168277983 19:55287536-55287558 CAGGGCGAGGAGCTGGAGCTGGG - Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
926349449 2:11982054-11982076 CAGGATAGGGTGATGGAGCTAGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927036183 2:19179067-19179089 TAGAATGAGCAGGTGGAGCAAGG - Intergenic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
933409682 2:81909891-81909913 CAGGATGTGCAAAAGGAGCATGG + Intergenic
933532612 2:83529728-83529750 CCAGATGCTCAGATGGAGCTTGG + Intergenic
936587120 2:113767872-113767894 CAGGATAAGGAAATGGAACTTGG + Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
937918558 2:127113771-127113793 GAGGATGAGCACATGAAGTTTGG + Intergenic
938452196 2:131431359-131431381 CAGGCCAAGTAGATGGAGCTTGG + Intergenic
938613292 2:132971387-132971409 CTGGATGGGCAGATGGGGCTAGG + Intronic
938810987 2:134852617-134852639 CAGGCTGAGCAAATCGAGTTTGG + Intronic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
943523608 2:188988104-188988126 CAGGATGACCAGATGTACCAGGG - Exonic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
945314770 2:208359967-208359989 CGGGAGGAGCGGATGGGGCTTGG + Intronic
945587794 2:211688347-211688369 CAGGTTGAGAAGACAGAGCTAGG - Intronic
946114013 2:217445977-217445999 CAGGAAGAGCAGACAGAGCTGGG + Intronic
946250216 2:218406817-218406839 CACGATGGGGAGGTGGAGCTGGG - Intergenic
948005005 2:234601025-234601047 CAGGTTGAGGAGGTGGAGATGGG + Intergenic
948068679 2:235102270-235102292 AATGATGACCAGCTGGAGCTGGG - Intergenic
1168795823 20:609735-609757 CAGAAGGTGCAGATGGAGCGCGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1170708197 20:18765173-18765195 AAGGAAGAGCTGAAGGAGCTGGG + Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171152002 20:22835486-22835508 GAGGAAGAGCAGCTTGAGCTAGG + Intergenic
1171309391 20:24134444-24134466 CAAGGGGTGCAGATGGAGCTTGG + Intergenic
1172499924 20:35418459-35418481 AAAGATGGGCAGAGGGAGCTTGG - Intergenic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1174028440 20:47599858-47599880 CAGGAAGTGGAGATGGATCTGGG - Intronic
1174536389 20:51254711-51254733 CAGGATGGGGAGAAGCAGCTTGG - Intergenic
1175231777 20:57478068-57478090 GAGGATGAGGAAATGAAGCTGGG + Intergenic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176039289 20:63055957-63055979 GAGCAGGAGCAGCTGGAGCTTGG + Intergenic
1176820637 21:13652057-13652079 CAGGAAGAGCAGATGGCACTGGG + Intergenic
1177641763 21:23852780-23852802 AAGAATGAGAAGTTGGAGCTTGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1179642083 21:42754347-42754369 CAGGATGAGCAGATGGCTCGGGG - Intronic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180791149 22:18576497-18576519 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1181230589 22:21418817-21418839 CAGGATGGAGGGATGGAGCTGGG + Intronic
1181248061 22:21516052-21516074 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1181404387 22:22672425-22672447 GAGGAGGAGGAGATGGAGCAGGG + Intergenic
1183089165 22:35509645-35509667 CAGGCTGAGCCGCTGGGGCTGGG - Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183861051 22:40670312-40670334 AAGGATGAGTAAATGGAGATGGG + Intergenic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185068643 22:48644441-48644463 CACCATGGGCAGAAGGAGCTGGG + Intronic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
1185101202 22:48841805-48841827 GAGGATCTGCAGATGGAGCTGGG + Intronic
1185103236 22:48852867-48852889 GAGGATCTGCAGATGGAGCTGGG - Intergenic
1185173691 22:49307383-49307405 CAGGCTCAGCAGAGGGGGCTGGG + Intergenic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
951300864 3:20994774-20994796 CCGGAGGAGCAGCTGGAACTCGG + Intergenic
951853344 3:27167895-27167917 CAACATGAGCAAATGGAACTAGG - Intronic
952408162 3:33024026-33024048 CAGGATGAGCAGATGAGACATGG - Intronic
953179201 3:40580872-40580894 CAGGATTTGCAAATGGACCTAGG - Intergenic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
954337798 3:49929840-49929862 CGGGCTGAGCGGCTGGAGCTGGG - Exonic
954751913 3:52818611-52818633 CAGGATGGGGGGCTGGAGCTTGG - Exonic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
966898579 3:184464242-184464264 TAGGAAGAACAGATGGACCTAGG - Intronic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969444243 4:7235034-7235056 GAGGCTGAGCATCTGGAGCTGGG + Intronic
970151635 4:13096470-13096492 CAGGAAGAGCATCTGGGGCTTGG - Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
971280342 4:25238115-25238137 AAAGATGAGAAGATGGAGCCTGG + Intronic
976189846 4:82477479-82477501 CAGGAGGAGCAGGTGGAACGTGG + Intergenic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
978414172 4:108458299-108458321 AGGGATAAGCACATGGAGCTGGG + Intergenic
980320460 4:131266543-131266565 CAGGTTTAGCAGATGCATCTTGG + Intergenic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
982657661 4:158170133-158170155 CATGATGAGGAGAGGAAGCTAGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985041264 4:185893848-185893870 CAGGAAGAGCAGATGGGAATGGG + Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
985511470 5:316369-316391 CAGGATGAGCACATCGGCCTTGG - Intronic
985745980 5:1647933-1647955 CAGGAGGAGCAGATAGAACTTGG + Intergenic
985815787 5:2126721-2126743 AAGGAAGAGCAGAAGGCGCTAGG + Intergenic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
986348066 5:6852892-6852914 CAGGCTGTGCAGAAGGTGCTGGG + Intergenic
987300174 5:16590165-16590187 CAGGATCAGCAGCTGGGGTTGGG - Intronic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988957206 5:36331736-36331758 CAGGATCAGAACATGGAGATTGG - Intergenic
990804462 5:59643246-59643268 TAAGTTGAGGAGATGGAGCTGGG + Intronic
990864590 5:60366998-60367020 TAGGATGAGTGGTTGGAGCTTGG - Intronic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
993147461 5:84113454-84113476 CAGGTTGAGCAGGAGCAGCTGGG + Intronic
994011867 5:94913965-94913987 CAGGAGGATCACTTGGAGCTAGG - Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG + Intergenic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
999776555 5:154816749-154816771 TAGGATGAACAGAGGGATCTGGG - Exonic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1002172404 5:177382795-177382817 AAGCCTGAGCAGACGGAGCTTGG + Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006216420 6:32447265-32447287 AAGGATGAGTAGATGGAGCCTGG - Intergenic
1006243041 6:32703482-32703504 CAGGAAGAGAAGACGGAGGTTGG - Intergenic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006744880 6:36334519-36334541 GAGGAGGAGCAGTTGGAGCGGGG - Intronic
1007825006 6:44593886-44593908 CAGGAAGAACAGATGCAGCCAGG + Intergenic
1012512887 6:100024805-100024827 TGGGAAGAGGAGATGGAGCTGGG + Intergenic
1013318308 6:108962268-108962290 CAGGATGCCAAGATGGACCTAGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1018083625 6:160279814-160279836 CATGCTGAGCAAATGAAGCTAGG - Intergenic
1018463688 6:164022882-164022904 CAGGATTGGGAGATGGATCTTGG - Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022662857 7:32382550-32382572 AGGGATGAGCAGACTGAGCTTGG - Intergenic
1022778647 7:33554963-33554985 CAAGGTCAGCAGATGGAGCAAGG + Intronic
1022784460 7:33624434-33624456 CAGGATGAGGAGATACAGATGGG - Intergenic
1023355917 7:39366839-39366861 AAAGATGTGCGGATGGAGCTGGG + Intronic
1025783371 7:64621571-64621593 CAGTTTGAGCTGCTGGAGCTGGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027474461 7:78611945-78611967 AAGGATGAGAAGCTGGAGTTTGG - Intronic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031765737 7:125774666-125774688 GAGGATGAGTAAATGGAGGTAGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1033604098 7:142912761-142912783 CAGGAAGAGGACATGGAGATGGG + Intronic
1033606650 7:142932638-142932660 CAGGAAGAGCAGCTGGGGCAGGG - Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1035246005 7:157562265-157562287 CAGGAGGAGAAAATGGAGCGGGG + Intronic
1035270145 7:157714984-157715006 CAGGAAAAGCACATGGGGCTGGG - Intronic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1037985706 8:23289276-23289298 CTGGCTGAGCAGCTGCAGCTAGG - Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1038430877 8:27498330-27498352 CAGGAAGAGGAGCTGGAGCTAGG + Intronic
1038492895 8:27982754-27982776 CAGGACGAGCTGGAGGAGCTGGG + Intronic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1039649628 8:39327905-39327927 CAGTTTGAGCTGCTGGAGCTGGG + Intergenic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041390529 8:57343633-57343655 CAGGCTGAGAGAATGGAGCTAGG - Intergenic
1042093516 8:65185898-65185920 GAGGAAGAGGAGATGTAGCTTGG - Intergenic
1043453953 8:80395325-80395347 CAGGATGATCACTTGAAGCTAGG + Intergenic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1044360714 8:91280492-91280514 AAGGAGGAGCAAATGGATCTTGG - Intronic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045341289 8:101256945-101256967 CAGGATGGGCACCTGGAGCCGGG + Intergenic
1046444981 8:114306670-114306692 CAGGATGAGGAGGAAGAGCTGGG - Intergenic
1047719716 8:127628386-127628408 CACGGTGAGCAGAAGGATCTAGG - Intergenic
1048904834 8:139077547-139077569 CAAGATGAGCATATGGATTTCGG - Intergenic
1049277854 8:141728869-141728891 GGGGATGGGAAGATGGAGCTGGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1050710924 9:8462302-8462324 GAAGAAGAGCAGATGGACCTGGG - Intronic
1050735102 9:8752828-8752850 CTGGATCAGCAGTTTGAGCTGGG - Intronic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1053545376 9:39017955-39017977 CAGAAAGAGGAGATGCAGCTGGG - Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1055023882 9:71698701-71698723 TATGAAGAGCAGATGGACCTGGG + Intronic
1055852542 9:80649706-80649728 CAAGATGGGAAGCTGGAGCTGGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1057934645 9:99226672-99226694 CACGATGAGCAGCTGGGGTTGGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1061473179 9:130843709-130843731 CAGGAAGAGCAGAAGAGGCTGGG + Intronic
1061781043 9:132996256-132996278 CATGGTGAGCAGCTGGGGCTGGG - Intergenic
1061817954 9:133207571-133207593 CAGGAGCAGCTGCTGGAGCTGGG - Intronic
1062242445 9:135547603-135547625 CAGGAGCAGCTGCTGGAGCTGGG + Intronic
1062273541 9:135720501-135720523 TAGGAAGAGATGATGGAGCTGGG - Intronic
1203787051 EBV:133898-133920 CGGGAAGAGCTGCTGGAGCTGGG + Intergenic
1186604559 X:11076949-11076971 CAGGAAGAGTAGATGGGGGTGGG - Intergenic
1189194779 X:39143725-39143747 AAGGACGAGCAGATGGAGGGAGG - Intergenic
1189491457 X:41474286-41474308 CAGGTAGAGCAGCTCGAGCTCGG - Exonic
1194020293 X:88681839-88681861 CAGGGTGAGCTGATAGAGCACGG + Intergenic
1194914586 X:99689837-99689859 CAGGAAGAGAAGATGGTGATTGG + Intergenic
1196863038 X:120045441-120045463 CAGAATGGGCAGAAAGAGCTGGG - Intergenic
1196880064 X:120190903-120190925 CAGAATGGGCAGAAAGAGCTGGG + Intergenic
1197318918 X:125003939-125003961 CAGGTTGAGTAGATGGAGTTAGG - Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1198375045 X:136030526-136030548 CAGGAAGAGCAGCTGGAGTGGGG - Intronic