ID: 915729089

View in Genome Browser
Species Human (GRCh38)
Location 1:158040273-158040295
Sequence TCTTTCCCCAGTTAGATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915729089 Original CRISPR TCTTTCCCCAGTTAGATGTA TGG (reversed) Intronic
902164545 1:14559687-14559709 TCCTTCCCTAGTTAGAGGTAAGG + Intergenic
902754839 1:18542148-18542170 TCTTTCCCTAATTTGCTGTATGG - Intergenic
904401181 1:30257729-30257751 TCTTTCCTCAGGTAGCTGTGAGG + Intergenic
906037706 1:42762685-42762707 TCTTTCCCAAGTCAGATTTAGGG + Intronic
907605179 1:55809243-55809265 TTTTTCCTCTTTTAGATGTAGGG - Intergenic
907652332 1:56306987-56307009 TATTTCTCCACTTTGATGTAGGG - Intergenic
908280543 1:62530216-62530238 TCTTTCCTAAGTTGGAAGTAAGG - Intronic
909824512 1:80110598-80110620 TCTTTCCCAAGATTGATGTCCGG + Intergenic
910113246 1:83703964-83703986 TTTTTCCTCATTTATATGTAGGG + Intergenic
910847095 1:91614153-91614175 TGTTTCCCCAGTTAGCTGGCTGG - Intergenic
911651757 1:100396873-100396895 TCTCCCCCCACTTAGATATAAGG - Intronic
913428192 1:118758371-118758393 TCTTTCCTCAGTGAGAAGTTGGG - Intergenic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915729089 1:158040273-158040295 TCTTTCCCCAGTTAGATGTATGG - Intronic
915806473 1:158858791-158858813 TGTTTCCCCAGTTATCTGTGAGG - Intergenic
917136450 1:171792533-171792555 TCTTTGCCCAGTTAGACTTCAGG - Intronic
917250186 1:173050735-173050757 TTTTTCTCCAATTAGAGGTAAGG - Exonic
917467581 1:175295749-175295771 TCTTTTTCCAGTTACATTTATGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
924165228 1:241274345-241274367 TCTTTTACCAGTTAGGTGTCTGG - Intronic
1062858259 10:790324-790346 TCTCTCCCCAGCAAGCTGTAGGG + Intergenic
1063748111 10:8909829-8909851 TCTTTCCACATTGAAATGTAAGG + Intergenic
1065775413 10:29115245-29115267 TCTTTCCCCAGAAAGCTGCATGG - Intergenic
1070490734 10:76973959-76973981 TGTTTCCCCAGTGAGATTTAAGG + Intronic
1075278171 10:121113887-121113909 TCTTATTCCAGTTTGATGTATGG - Intergenic
1075894523 10:125983587-125983609 TCTTCCCCCAGATAGTTGCAAGG - Intronic
1075944406 10:126419751-126419773 GCTGTCCCCAGTTAGCAGTAAGG + Intergenic
1075988158 10:126806431-126806453 AATTTCCCCAGATAGGTGTAAGG + Intergenic
1078426201 11:11253348-11253370 TCTTCCCCCAGTCAAATGAACGG + Intergenic
1079725984 11:23881733-23881755 TTTTTCCCCTGTTAGTTGTGTGG + Intergenic
1079990149 11:27237998-27238020 TGTTTCCCTAGTGAGATGTCTGG - Intergenic
1081197348 11:40177561-40177583 TCTTCCCCCAGATAGCTATAGGG + Intronic
1084512931 11:69617382-69617404 TCTTTCCCTAGCTAGCTGCAAGG - Intergenic
1085060429 11:73440958-73440980 TTTCTCCCCAGTCAGCTGTATGG - Intronic
1087998502 11:104842969-104842991 TCTTTCTCTATATAGATGTAAGG - Intergenic
1090027559 11:123180770-123180792 TCTTTCCCCAGATGGCTGCAAGG - Intronic
1090258755 11:125303929-125303951 GCTTCCCCCAGCTAGATGCATGG + Intronic
1092860189 12:12713474-12713496 TCTTTCCCCAGATAGCTGTATGG + Intergenic
1093110275 12:15143899-15143921 TCTGTCCCCAGATACATGGATGG - Intronic
1096617406 12:52841584-52841606 TCTTTCCTGAGTCAGATGTGAGG - Intronic
1097813574 12:64046063-64046085 TCCTTCCCCAGATAGCTGCATGG - Intronic
1100281185 12:93119907-93119929 TCTTTCCCCAGTCTGATGTTAGG - Intergenic
1100557200 12:95707392-95707414 TCTTTCCCCAGTTAACTCTTTGG + Intronic
1100704655 12:97186889-97186911 TTTCTCCCAAGTTAGCTGTAGGG - Intergenic
1101122708 12:101599634-101599656 CCTTTCCCCAATTTGAGGTAAGG - Intronic
1102503546 12:113369321-113369343 TTTCTCCCCAGATAGATGAAGGG - Intronic
1105572614 13:21618222-21618244 TTTTTTCCCAATTAGATGGAAGG + Intergenic
1106123447 13:26881184-26881206 TCTTTCCCCTGTTAGCTCTCTGG + Intergenic
1106493931 13:30257263-30257285 TCTTTCCTGAGTCAGATTTATGG + Intronic
1107409855 13:40148489-40148511 TCTTTCTGCATTGAGATGTATGG + Intergenic
1107819337 13:44272175-44272197 TCTTTCCCCAGTGGCAAGTAGGG - Intergenic
1113217333 13:108057679-108057701 TCTTTCCCAATTTAGGTTTAGGG + Intergenic
1114508595 14:23237681-23237703 TGTTTCCACAGTAACATGTATGG + Intronic
1117063519 14:51986343-51986365 TCTTTCCCCAGATATTTGTGTGG + Intergenic
1117232813 14:53738850-53738872 TCTGTCCCCAGAAAGATGTAAGG - Intergenic
1120171087 14:81247794-81247816 TCTTTCTCTAGCTGGATGTATGG + Intergenic
1121094442 14:91206119-91206141 GCTTTCCCCAGGGAGATTTAAGG - Intronic
1123501187 15:20882603-20882625 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123558439 15:21456308-21456330 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123594670 15:21893583-21893605 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1125437637 15:39664633-39664655 TGTTTTCCCAGTGAAATGTAAGG - Intronic
1125809541 15:42525885-42525907 TCTTTCCACAATTAGATATAAGG - Intronic
1126298972 15:47174219-47174241 TCCTTCCCCAGCTATATGCATGG - Intergenic
1126867278 15:52950100-52950122 TGTTTCCCCAGTTAGATGCATGG + Intergenic
1127324172 15:57878808-57878830 TCTATACCCAGTTTGATGAAGGG - Intergenic
1128010969 15:64295629-64295651 TCTCTCCCAAGATAGGTGTAAGG - Intronic
1130332327 15:82932185-82932207 TCATTCCCGAGTAAGATGTAGGG + Intronic
1131290813 15:91105357-91105379 TCTTTCCCCAGATAACTGTCTGG - Intronic
1131784649 15:95898921-95898943 ACTTTGGCCAGTTAGATGTGAGG - Intergenic
1132321301 15:100927416-100927438 TCTTTCCCCAGTGGGATCTCAGG + Intronic
1202966789 15_KI270727v1_random:183458-183480 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1133661283 16:7920261-7920283 TATTTTCCCAGTTAAATATAAGG - Intergenic
1135639426 16:24108216-24108238 TGTTTCCACAGTAACATGTATGG + Intronic
1137512448 16:49113628-49113650 TTTTTTCCCAGTTACATGCATGG - Intergenic
1140774364 16:78236559-78236581 TCTTTCCCCATTTGGATGGTGGG + Intronic
1143097703 17:4487274-4487296 TCTTTCCCCAGGTCGCTGAACGG - Intronic
1145923934 17:28632043-28632065 TCTTTCCCCAGCTGCAGGTAAGG - Exonic
1149220424 17:54410794-54410816 TCTTGCCCCAGATACATGCATGG - Intergenic
1149348098 17:55758928-55758950 TCTTTCACCAGATTGCTGTATGG + Intronic
1150462511 17:65364451-65364473 TCTTTCCCCAGTTAGGGGGAAGG - Intergenic
1156335854 18:36170790-36170812 TGTTTCCCCAGCTGGCTGTAGGG - Intronic
1156626058 18:38910740-38910762 TCTGTCCCTAATTAGCTGTATGG - Intergenic
1157943850 18:51957050-51957072 TCTTGTCCCAGTTAGAGATATGG - Intergenic
1158862873 18:61610192-61610214 TCTTTCATCAGTTTGATTTATGG + Intergenic
1159586128 18:70285299-70285321 TTTTTCCCCTTTTAGATGAAGGG + Intergenic
1164200206 19:23011803-23011825 TCTTTCCCCAAGTAGATCTCTGG - Intergenic
1167718605 19:51161280-51161302 TCTGTTCCCATTTGGATGTAAGG - Intergenic
1168067932 19:53929990-53930012 TCCATCCCCAGTTAGATGCTAGG - Intronic
1168367062 19:55797339-55797361 TCTTTCCCCAGATAGCTGCATGG + Intronic
926966834 2:18424280-18424302 TTCTTCCCAAGTTAGTTGTAAGG + Intergenic
928709945 2:33992797-33992819 TCTTTCCCTTGTTAGCTGTAGGG - Intergenic
929631270 2:43465311-43465333 TATTTCTCCAGTTACATTTAAGG + Intronic
930039862 2:47113389-47113411 TCTTTGCCCAGTTATCTGTTGGG - Intronic
930886579 2:56333303-56333325 TCTGTCCCCAGTCAAATGTTTGG - Intronic
931050848 2:58412730-58412752 TCTTTCCCCAGGTATATCAAAGG - Intergenic
932089344 2:68791037-68791059 TCTTTCCCCAGGTAGCTGCATGG + Intronic
932978908 2:76639271-76639293 TCTTTCCCCACTAACATTTAAGG - Intergenic
933452763 2:82477815-82477837 TCTTTCCCCAGTTTGCTGAAGGG - Intergenic
935354944 2:102189065-102189087 TCTTTCCCTAGATGGATGCAAGG + Exonic
935469192 2:103436537-103436559 TCTTTCCCCTGTTGGAAGGATGG + Intergenic
935555075 2:104501069-104501091 TCTTGCCCCAGCTGGAGGTACGG + Intergenic
935948611 2:108308665-108308687 TCTTTCCAAAGTAAGATATAAGG + Exonic
942119480 2:172762587-172762609 TTTGTCCCCAGTTAGAGGCAGGG + Intronic
942796391 2:179825574-179825596 TCTTTCCCAAATTACTTGTAAGG + Intronic
1172879033 20:38185974-38185996 TCTTTCCCCTGTTGAATGAATGG + Intergenic
1178588712 21:33891439-33891461 TTTTTCCCCAGTTAAATTCAGGG - Exonic
1183950104 22:41347980-41348002 TCCTTCCCCAGCTAGCTGTGTGG + Intronic
1184581394 22:45420277-45420299 TCTTTCCCCAGATATCTGTAGGG + Intronic
1185073874 22:48672441-48672463 TTTTTCCCCTGATAAATGTAAGG - Intronic
949709037 3:6853564-6853586 TCTTCCCACAGTCATATGTATGG - Intronic
951765063 3:26188481-26188503 ACTATCTCCAGTTAGATTTAAGG - Intergenic
955110989 3:55949672-55949694 TCTTTCTCCAGTTATATATTAGG - Intronic
957946397 3:87068696-87068718 TATTTCCCCAGTTTGAAGCAAGG - Intergenic
958713837 3:97753733-97753755 TATTTCCCCTGTTAAATGGATGG - Intergenic
959049869 3:101514240-101514262 TCAGTCCCCAGGTAGAGGTAAGG + Intergenic
959842254 3:110991101-110991123 TCTTTTCCCAGTTATCTGCATGG - Intergenic
960934473 3:122889212-122889234 CCTTTTCCCAATTAGATGGAAGG - Intergenic
963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG + Intronic
963725811 3:148920211-148920233 TCTTTCCCCAGGAAGAAGTTAGG - Intergenic
964041252 3:152264443-152264465 AGTTTCCCCAGTTTAATGTAAGG - Intronic
964057546 3:152479710-152479732 TCTTTCCCAAGGTCGATGTACGG + Intergenic
964729902 3:159853496-159853518 TCTTTCTCCAGTTAGAAAAATGG - Intronic
968257895 3:197295366-197295388 TCTATCAACAGATAGATGTAAGG + Intronic
974729821 4:65847696-65847718 TCTTTCTCCATATATATGTAAGG + Intergenic
975765592 4:77664247-77664269 TCTTTCCCCATTAAGGTGTAGGG + Intergenic
975910887 4:79265618-79265640 TCTTTCTCCAGTTAAATGCATGG + Intronic
975919638 4:79369810-79369832 TCTTTCCCCAGATGGCTATAGGG - Intergenic
977419995 4:96787364-96787386 TCTTTCTCCAGATAGATGTATGG - Intergenic
977609042 4:99013847-99013869 TCATTCCCCGGTTAAATGTTAGG - Intronic
977610070 4:99021928-99021950 TCATTCCCCGGTTAAATGTTAGG - Intronic
981143640 4:141300356-141300378 ACTTTCCCCAGTTAGTTATGTGG + Intergenic
983365750 4:166786189-166786211 TCTTCCCCCAGGTATCTGTATGG - Intronic
983437826 4:167737914-167737936 TGGTTCCCCAGTTAGTTGTGTGG + Intergenic
984007441 4:174329776-174329798 TCTTTCTCAAGATAGATTTATGG + Intronic
984016064 4:174428473-174428495 TCTTTTCCCAGATATGTGTATGG - Intergenic
991338756 5:65581142-65581164 TATTTACCCATTTAGATGGAAGG - Intronic
994070704 5:95598870-95598892 CCTTTCCCCAGATAACTGTAGGG + Intronic
994395456 5:99222856-99222878 CCTTTCCCCAGTTGGATATTAGG + Intergenic
995539235 5:113168415-113168437 TCTTTCCCCCATTACATTTATGG + Intronic
996413035 5:123179856-123179878 TCTTTCCCCAGGCAAATGTTAGG - Intronic
996671954 5:126128392-126128414 CCATTCCCCAGTTAGTTGAAAGG + Intergenic
997702964 5:135917780-135917802 TCTTTCCACAGTTATCTGTGAGG - Intergenic
998628962 5:143877510-143877532 TCTTTCGCCAATTAGGTTTATGG + Intergenic
1000735997 5:164901501-164901523 ACTTTCCCCCCTTAGATGAAGGG + Intergenic
1003360909 6:5424195-5424217 TCTTCCACCAGTTAGTTCTATGG + Intronic
1004844897 6:19629995-19630017 TCTTTCCCCAGTGATTTGTTAGG - Intergenic
1005202987 6:23368110-23368132 TCTTTCCCCAGTAAGTTTTGAGG + Intergenic
1008691489 6:53984104-53984126 TATTTCCCTAGTTATATGAAAGG - Intronic
1009039058 6:58155864-58155886 TCTTTCCCCAGTAAGGAATATGG + Intergenic
1009214952 6:60910703-60910725 TCTTTCCCCAGTAAGGAATATGG + Intergenic
1009456733 6:63865669-63865691 TTTTTCCCCAGCTATCTGTATGG + Intronic
1009980802 6:70723446-70723468 TCTTTCCCCAGATAGCTGCATGG + Intronic
1013532824 6:111035724-111035746 TCTTTTCCCACTTAGATAAAGGG - Intergenic
1015686886 6:135874146-135874168 TCTTTCCCCAGGTATCTGCATGG - Intronic
1016947418 6:149547400-149547422 TCTTCCTCCAGTTATTTGTATGG + Intergenic
1018174177 6:161164555-161164577 TCTTTCCCCTGGAAGATGTTGGG - Intronic
1019967129 7:4508651-4508673 TTTTGCCCCAATTAGAGGTAGGG - Intergenic
1022358113 7:29634969-29634991 TCTTTCCCCAGATAGAGGCTGGG + Intergenic
1024742470 7:52369911-52369933 TCTTTACCCAGTCAGATCCATGG - Intergenic
1026868623 7:73837418-73837440 TGTTTCCACAGTAACATGTATGG - Intronic
1027776668 7:82473632-82473654 TCTTCCCCCAGATTGCTGTATGG - Intergenic
1030206933 7:106960159-106960181 CCTTTCCCCAGTTACCTGTAAGG + Intergenic
1032663496 7:134011933-134011955 TCTTTCCCTAGATAGCTGCATGG - Intronic
1033268682 7:139911333-139911355 TCTTTCCGCATATAGATGGATGG + Intronic
1035056833 7:156041466-156041488 TCTTACCCCAGCAAGGTGTAGGG - Intergenic
1038857382 8:31348523-31348545 TCTTTCCCCAAATAGACCTATGG + Intergenic
1043933467 8:86116834-86116856 TCTTTCCACAGGTTGTTGTAGGG - Intronic
1046877872 8:119276373-119276395 TGTTTTCCCAGTTAGTTGGAAGG - Intergenic
1047348892 8:124054641-124054663 TCTTTGCCCAGTTAGTTGCATGG - Intronic
1048592895 8:135837857-135837879 TCTTTCCCCAGTTAGTTGCTGGG + Intergenic
1048971934 8:139650004-139650026 TCTTTCCCCAGGTAGCTGCCTGG - Intronic
1049213087 8:141395654-141395676 ACCTTCCCCAGGTAGATGAACGG - Intronic
1054953326 9:70878887-70878909 GTTTTCCCAACTTAGATGTAAGG - Intronic
1055382040 9:75718030-75718052 TATTTCCCTAGTTAGTTGTCAGG - Intergenic
1055969147 9:81894394-81894416 TCTTTCCACACTTAGTTGTTGGG - Intergenic
1058342467 9:103915414-103915436 TCTTTCACCAATTAGATGTATGG + Intergenic
1059680622 9:116581927-116581949 TCTTTCCCCAGGGAGGTGGAAGG + Intronic
1059867630 9:118534108-118534130 CCTTGGCACAGTTAGATGTAAGG - Intergenic
1060647220 9:125291327-125291349 TGTTTCCCCAGCTACATGTGTGG + Intronic
1060677022 9:125524297-125524319 TCATTCCCCACTTAGAGATAAGG - Intronic
1060906202 9:127308272-127308294 TATTTCCCCAGTTAGATTCAGGG - Intronic
1187110543 X:16294605-16294627 TCTTGCCCCAGTAAAATGCATGG + Intergenic
1189351209 X:40277180-40277202 TCATTCCCAATTTAGACGTAAGG - Intergenic
1189577839 X:42374715-42374737 TCCTGCCCCAGTTTGATTTAAGG + Intergenic
1190264158 X:48817564-48817586 TCCTTCCCCAGAAAGAAGTAAGG + Intronic
1190914721 X:54802892-54802914 TTTTTCCCCTTTTATATGTAGGG - Intergenic
1196692200 X:118571874-118571896 TCTTCCCTCAGATAGCTGTATGG - Intronic
1196752248 X:119128529-119128551 TCTTTCCCCACATAGTTGCATGG + Intronic
1198428170 X:136540426-136540448 TCTTTCCCCAGATACCTGCATGG + Intronic