ID: 915732035

View in Genome Browser
Species Human (GRCh38)
Location 1:158060652-158060674
Sequence CTGCCCCATATGACTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915732035_915732039 4 Left 915732035 1:158060652-158060674 CCCTCATCAGTCATATGGGGCAG 0: 1
1: 0
2: 2
3: 16
4: 133
Right 915732039 1:158060679-158060701 CTCAGAATTCCTGCTCTTCCTGG 0: 1
1: 0
2: 7
3: 29
4: 276
915732035_915732041 17 Left 915732035 1:158060652-158060674 CCCTCATCAGTCATATGGGGCAG 0: 1
1: 0
2: 2
3: 16
4: 133
Right 915732041 1:158060692-158060714 CTCTTCCTGGCAGCCCAGCCAGG 0: 1
1: 0
2: 11
3: 1346
4: 1248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915732035 Original CRISPR CTGCCCCATATGACTGATGA GGG (reversed) Intronic
901026197 1:6279900-6279922 CTTCCCCACATGGCTGAGGAGGG - Intronic
903542219 1:24102966-24102988 CTGCCTGATGTGATTGATGATGG + Intronic
903958835 1:27043733-27043755 CAGGCCCAAATGACTGTTGAGGG + Intergenic
904376282 1:30084412-30084434 CTTTCCCATTTGACAGATGAGGG - Intergenic
905469201 1:38179119-38179141 CTGCCCCAAAAGAATGATGTAGG - Intergenic
907764624 1:57396709-57396731 TGGCCCCATTTGACAGATGAAGG - Intronic
908541395 1:65126034-65126056 CTGCCCAAGTTGACTGAGGAGGG + Intergenic
910990700 1:93053063-93053085 CTGCCACATCTCACTGGTGAAGG + Intergenic
913581610 1:120232816-120232838 CTGGCTCAGATGAATGATGACGG - Intergenic
913626567 1:120665572-120665594 CTGGCTCAGATGAATGATGACGG + Intergenic
914563542 1:148844263-148844285 CTGGCTCAGATGAATGATGACGG - Intronic
914609285 1:149285962-149285984 CTGGCTCAGATGAATGATGACGG + Intergenic
915630639 1:157151709-157151731 CTGCCACTTATGATTGATGAGGG - Intergenic
915732035 1:158060652-158060674 CTGCCCCATATGACTGATGAGGG - Intronic
916850285 1:168696298-168696320 CTGCTTTATATGACTGATGATGG - Exonic
920966564 1:210706008-210706030 TGGCCCCATTTGACAGATGAAGG + Intronic
921530167 1:216272541-216272563 CTTACCCAGAAGACTGATGATGG - Intronic
1069546159 10:69330376-69330398 CTGCCCCATATGTAAGATGCAGG - Intronic
1069776423 10:70929857-70929879 CTCTCCCATTTGACAGATGAAGG + Intergenic
1072038770 10:91588433-91588455 CTGCTCCCTATGACTCATCACGG + Intergenic
1074788219 10:116860550-116860572 CTACCTCATATGATTGATGAAGG + Intronic
1075462712 10:122629223-122629245 CTGCCTCATCTGTCTGATGAGGG - Intronic
1076565088 10:131393211-131393233 CTGCCGCAAATGACTGTGGAAGG + Intergenic
1077241968 11:1515374-1515396 CTGCACCACATGCCTGATAAAGG + Intergenic
1077548761 11:3189757-3189779 CGGCCCCAAATGGCAGATGAGGG + Intergenic
1078823660 11:14906597-14906619 CTGCCCAATATGGCTGAAGAAGG - Intronic
1080838279 11:35960913-35960935 CTGCCCCTGATGACTGGTCAGGG + Intronic
1083175334 11:60946364-60946386 CTGCCCGCTGTGACTGAGGATGG - Intronic
1084321516 11:68375972-68375994 CTGCCCCAACTGACAGAAGATGG - Intronic
1085040200 11:73322401-73322423 CTTCCCCATCTGAATGATGCAGG - Intronic
1087313497 11:96577979-96578001 CTGCCTCATATGGCTGCTGCTGG + Intergenic
1088533025 11:110831003-110831025 CTTCACCAGATGACAGATGATGG + Intergenic
1088737569 11:112740343-112740365 CCTCCCCATATGGCTGGTGAGGG + Intergenic
1089010230 11:115126302-115126324 CAGCCACAGATGACTGATGAGGG + Intergenic
1089376783 11:118000168-118000190 CTGCCCCAGAGGCCCGATGAGGG - Exonic
1091325541 11:134684218-134684240 CTGCCTCATATGGCTGCTGCGGG - Intergenic
1091407875 12:220424-220446 CTGGTCCACATGCCTGATGATGG + Intergenic
1092085562 12:5756511-5756533 CTGACCAGCATGACTGATGAAGG - Intronic
1093171448 12:15865489-15865511 CTGCCACATTTCACTGATGCTGG + Intronic
1094511648 12:31100879-31100901 CTGCCCAGTGTGACTGGTGATGG + Intronic
1096592204 12:52667812-52667834 CTGCGCCATATTTCTGATAATGG + Intergenic
1097577145 12:61409131-61409153 GTGCACCAGATGACTGGTGAGGG - Intergenic
1097651546 12:62304475-62304497 GTGGCCCACATGACTGATGCAGG + Intronic
1100280056 12:93110031-93110053 CAGCCCCATATGAGTAATGAAGG + Intergenic
1100308597 12:93374014-93374036 CTGCCTCATAAGGCTGATGCTGG + Intergenic
1101364136 12:104055871-104055893 CTGCCCCATATGTGTGATCTTGG - Intronic
1102216325 12:111163986-111164008 TAGCCCCATTTGACAGATGAAGG - Intronic
1103190225 12:118994731-118994753 TGGCCCCATATTACAGATGAGGG - Intronic
1104828364 12:131730977-131730999 CTGACCCCTATGGCTGATGCAGG - Intronic
1108079316 13:46717947-46717969 CTGCCCCATAAGGTGGATGAAGG + Intronic
1110611494 13:77492813-77492835 CTTCCCCATATGACTGATGCAGG + Intergenic
1112566271 13:100553391-100553413 CTGGCCCATTTGACTGTTGGTGG - Intronic
1113817723 13:113186224-113186246 CTGCCCCACATGAGGGATGAGGG + Intronic
1117571437 14:57052761-57052783 CTGCTCCTTATCACTGAAGACGG + Intergenic
1118543644 14:66859237-66859259 CTGACCCATACTACTGGTGATGG + Intronic
1120865734 14:89293894-89293916 CTGCCACAAATGTCTGTTGAGGG + Intronic
1121598562 14:95185456-95185478 CTGTCCCATCCAACTGATGAGGG - Exonic
1122599404 14:102913806-102913828 CTGGCCCAGATGAGTGATGCCGG + Intergenic
1122943658 14:104995025-104995047 CTGCCCCATGTGAATGCTGCTGG + Exonic
1123476188 15:20593802-20593824 TTGCCCCATAACTCTGATGATGG + Intergenic
1123641824 15:22406562-22406584 TTGCCCCATAACTCTGATGATGG - Intergenic
1126615337 15:50573229-50573251 CTGCCACATTTTACTGATCAAGG - Intronic
1130534339 15:84772624-84772646 CTCCCCCACATGACTGACTATGG - Intronic
1132299465 15:100767195-100767217 CAGCCCCATTTTACAGATGAGGG + Intergenic
1132870167 16:2112326-2112348 CTGCCCCAGGTGAGGGATGAGGG - Exonic
1134260201 16:12644991-12645013 CTTCCCCATTTTACAGATGAAGG + Intergenic
1134522378 16:14924630-14924652 CTGCCCCAGGTGAGGGATGAGGG + Intronic
1134710048 16:16323281-16323303 CTGCCCCAGGTGAGGGATGAGGG + Intergenic
1134717261 16:16363281-16363303 CTGCCCCAGGTGAGGGATGAGGG + Intergenic
1134949555 16:18345364-18345386 CTGCCCCAGGTGAGGGATGAGGG - Intergenic
1134957491 16:18388878-18388900 CTGCCCCAGGTGAGGGATGAGGG - Intergenic
1139972970 16:70787616-70787638 GTGCCCCAGATCACTGATGGAGG + Intronic
1142623257 17:1178235-1178257 CCCCCCCATATGACTTATCAAGG + Intronic
1146448539 17:32952944-32952966 CAGCCCCATTTGTCTTATGAAGG + Intergenic
1149297620 17:55274732-55274754 CTGCCTCATAGGACTGTTGAAGG + Intronic
1155083308 18:22431389-22431411 CTTCAACATATGAGTGATGAGGG + Intergenic
1157214947 18:45774982-45775004 ATGCCCCACATGCCTAATGAAGG + Intergenic
1157587711 18:48815687-48815709 CTGTCCCTTGTGAGTGATGAAGG - Intronic
1157651065 18:49331897-49331919 CTCCCCCATCCGACTGCTGAGGG + Exonic
1158553130 18:58453939-58453961 CTGCTCCAAATCTCTGATGATGG + Intergenic
1160498315 18:79388119-79388141 CTGCCCCATCTGCCTGTTGCTGG + Intergenic
1160784015 19:891481-891503 CTGGCCCAGGTGAGTGATGATGG + Intronic
1161545086 19:4875744-4875766 CTTCCCCAGAGGCCTGATGAGGG - Intergenic
1161991836 19:7688789-7688811 CTGCCCCATTTTATTGATGCAGG + Exonic
1162725538 19:12688065-12688087 CTGCCCAATGTCACTGTTGATGG - Intronic
1162893643 19:13751490-13751512 CTGGCCCACGTGAGTGATGATGG + Intronic
1163250459 19:16123705-16123727 CTGTCCCATATGACTGATACTGG - Intronic
1164647244 19:29868099-29868121 CTCACCCACATGTCTGATGATGG - Intergenic
1166662938 19:44659004-44659026 TTCCCCCATTTGACTGATGAGGG + Intronic
1166740741 19:45113433-45113455 CTGCCCCATTTTACCAATGAAGG + Intronic
927233987 2:20852917-20852939 CAGCCCCATGTGGCTGATGATGG - Intergenic
929141862 2:38673555-38673577 CGGCCCCATATTACTTTTGATGG - Intronic
933209107 2:79545405-79545427 CTGCTCCATATCACGGATGTGGG - Intronic
934568381 2:95353031-95353053 CTAACCCATATGACTAATGGTGG - Intronic
937704570 2:124904973-124904995 TTAAACCATATGACTGATGAAGG + Intronic
939406994 2:141771647-141771669 CTTCAACATATGACTGTTGAGGG - Intronic
942198474 2:173546613-173546635 CTGTCCCATAGGATTGATGGTGG + Intergenic
944046039 2:195413381-195413403 CTGCACCACATGACTGCTGCTGG - Intergenic
945498495 2:210539173-210539195 CTGCCTCATAGTACTGCTGAAGG + Intronic
948000073 2:234560506-234560528 CTTCCCCATACAAGTGATGAAGG - Intergenic
948326216 2:237123809-237123831 CTTCAACATATGACTGTTGAGGG - Intergenic
1169254574 20:4087056-4087078 CTAACCCATTTGACTGATAACGG + Intergenic
1170083093 20:12498217-12498239 CTTCCCCCTTTGACTCATGAAGG + Intergenic
1170546063 20:17436756-17436778 CTGTGGCATATGACTGATGGAGG - Exonic
1171979997 20:31621011-31621033 CTGCCCTAGATAACTGATCAAGG + Intergenic
1173121217 20:40291260-40291282 CTACCCCAAATGACTGATCGTGG + Intergenic
1174758874 20:53186802-53186824 CTCCCCCAAGTGATTGATGAGGG - Intronic
1182897386 22:33869858-33869880 CTTCCCCATACTCCTGATGACGG - Intronic
1183985204 22:41565975-41565997 CAGCCCCATTTGACAGATGAGGG + Intronic
1184600466 22:45540391-45540413 CTGACTCATTTGACTGAGGAGGG + Intronic
1184697081 22:46145777-46145799 CTGCCCCATTTTAGAGATGAGGG + Intergenic
951697554 3:25461523-25461545 CTTCTGCAAATGACTGATGAGGG + Intronic
954052673 3:47994423-47994445 CTTTCACCTATGACTGATGAGGG - Intronic
955581719 3:60430092-60430114 CTGCCCCATATGTCTCATTTTGG - Intronic
956166460 3:66401612-66401634 CAGCCCCATATGTCTGCTGGGGG - Intronic
961042952 3:123690164-123690186 TTGCCCCATAAGAGGGATGAAGG + Intronic
961220494 3:125195355-125195377 CTGCCCCATGTGACTGATGCTGG + Intronic
967224432 3:187277123-187277145 TTTCCCCATCTGCCTGATGAGGG - Intronic
970792305 4:19873122-19873144 CTGCCATATATGACTCAAGAAGG + Intergenic
974495859 4:62625733-62625755 CTACCCCATAGGACTGTTAAGGG - Intergenic
975990213 4:80251379-80251401 CTGCTACATATCAATGATGATGG + Intergenic
977209093 4:94197347-94197369 TTTCCCCATATTACAGATGAGGG + Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
983204970 4:164902385-164902407 CTGCCTCATCTGAGGGATGAGGG - Intergenic
992001764 5:72442961-72442983 ATGCCCCATAAGACAGATGCAGG - Exonic
999189093 5:149732965-149732987 CAGCCCCATTTGACAGATGGAGG - Intronic
1001049440 5:168402650-168402672 CTGCCATATATTACAGATGAGGG + Intronic
1003763758 6:9212832-9212854 CTCCCCCATAGGACTGATTATGG - Intergenic
1008685952 6:53926556-53926578 CTGCCCCATTTTAAAGATGAAGG - Intergenic
1009890402 6:69673733-69673755 CTGCCTCATATAACTGGTGTGGG + Intergenic
1010226661 6:73496058-73496080 CTGGCCCAGATGACTTCTGAGGG - Intronic
1016354355 6:143201982-143202004 CTGCCCTAAATAACAGATGAGGG + Intronic
1018388347 6:163324574-163324596 CTGCCCCAGATGTATGAGGAAGG - Intergenic
1023041746 7:36178704-36178726 CTGCCTCATGGGACTCATGATGG - Intronic
1028867986 7:95735927-95735949 CTGGCCCATTTGTCTGTTGATGG + Intergenic
1031339876 7:120585961-120585983 CTGAGCCATATGACTGCTGAAGG - Intronic
1039791355 8:40878301-40878323 TTGCCCCATCTCACAGATGATGG + Intronic
1043521435 8:81049998-81050020 CTGCCCCATTTGACACAGGATGG + Intronic
1044436949 8:92175968-92175990 CTGCCCCATATGCCCTAGGAAGG - Intergenic
1048876214 8:138838499-138838521 CTCTCCAATATGACTGCTGAAGG - Intronic
1053404204 9:37857100-37857122 CTGGCCTATAAGACTGAGGAAGG - Intronic
1056599306 9:88033949-88033971 CAGCCCCTAATGTCTGATGAAGG + Intergenic
1061895120 9:133643146-133643168 CAGCCCCATATGCATGAGGACGG + Intronic
1062233943 9:135499233-135499255 CTGCCCTAGAGGACTGTTGAGGG + Intronic
1192109216 X:68347204-68347226 CAGCCCCATTTTACTGATGAAGG - Intronic
1192274663 X:69616610-69616632 CTGCCCAAGGTGACTGGTGATGG - Exonic
1195001019 X:100643468-100643490 CTTCCCCTTATGACTGAGAAGGG + Intergenic
1198533713 X:137567404-137567426 CTGCCGCATATAACGGAAGAAGG - Exonic
1198539058 X:137617310-137617332 CTGCCTCCTATGATGGATGATGG - Intergenic
1198644044 X:138787208-138787230 CAGCCCCATCTGGCTGATTAAGG - Intronic
1199134855 X:144237052-144237074 CTGTCCCATAAGAGTGTTGATGG + Intergenic
1201265343 Y:12201078-12201100 CTGCCAGATGTGAGTGATGATGG + Intergenic