ID: 915732461

View in Genome Browser
Species Human (GRCh38)
Location 1:158063735-158063757
Sequence CCTGGTAAGCAGAGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 496}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915732461_915732469 28 Left 915732461 1:158063735-158063757 CCCTTCTCTCTCTGCTTACCAGG 0: 1
1: 0
2: 5
3: 39
4: 496
Right 915732469 1:158063786-158063808 TCAAAGACATCACTTCCTACAGG 0: 1
1: 0
2: 0
3: 17
4: 162
915732461_915732465 -1 Left 915732461 1:158063735-158063757 CCCTTCTCTCTCTGCTTACCAGG 0: 1
1: 0
2: 5
3: 39
4: 496
Right 915732465 1:158063757-158063779 GAAAACTCCTACTCATCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915732461 Original CRISPR CCTGGTAAGCAGAGAGAGAA GGG (reversed) Intronic
900500131 1:3000305-3000327 TTTGGGAAGCAGAGAAAGAAGGG - Intergenic
900721792 1:4181043-4181065 GGTGGTATGGAGAGAGAGAATGG + Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900841552 1:5052551-5052573 GGTGGTATGGAGAGAGAGAATGG - Intergenic
901191096 1:7410230-7410252 CCTGGGAAATAGAGACAGAATGG + Intronic
902787537 1:18742750-18742772 CCTGGTAAGCAGAGGGGCACAGG + Intronic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904585916 1:31580517-31580539 CCTGGTGTGCAGAGAGGGAAAGG + Intronic
904629857 1:31832722-31832744 CCTGGAAATCAATGAGAGAAAGG - Intergenic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
905908348 1:41635968-41635990 CCAGATTAGCAGAGAAAGAATGG + Intronic
906566921 1:46807431-46807453 CCTGGTAGGGATGGAGAGAAGGG + Intronic
906665015 1:47615302-47615324 ACGGGAAAGAAGAGAGAGAAGGG + Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908672581 1:66564372-66564394 CCTTGGAAGCAGAGAGTGACCGG + Intronic
909229193 1:73063099-73063121 CCTTATTAGCAGAGTGAGAAAGG + Intergenic
909512828 1:76474320-76474342 GCTGGAAAGTATAGAGAGAAAGG + Intronic
910492623 1:87789216-87789238 CCTGATAATCAAAGAGTGAAAGG - Intergenic
911379424 1:97093894-97093916 TTTGGCAAGCAGAGAGGGAAAGG - Intronic
912297207 1:108481534-108481556 CCTGCTATGCAGGGAGGGAAAGG + Intergenic
912363166 1:109111655-109111677 CATGGAAAGGAGAGAGAGAATGG - Intronic
912458783 1:109817618-109817640 CCTGGGCAGGACAGAGAGAATGG - Intergenic
912481748 1:109986906-109986928 CCTGGGAAGAAGAGAGGAAAAGG - Intronic
912558827 1:110535621-110535643 CTTGGAAAGGAGAGAGAGAGAGG + Intergenic
913047777 1:115088968-115088990 GCTGGTAGGCAGAGTGAAAAGGG + Intronic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
914353085 1:146857083-146857105 ACTGGTCAGTGGAGAGAGAATGG - Intergenic
914422503 1:147541977-147541999 CCTGGAAAAGAGGGAGAGAAGGG + Intronic
915058274 1:153157751-153157773 CCTTGTAAGCAGTGTGAGAACGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
917014043 1:170509296-170509318 ACTGGTAAGGATACAGAGAAAGG + Intergenic
918235195 1:182573439-182573461 CCTAGTATGTAGTGAGAGAAGGG - Intergenic
919246721 1:194996910-194996932 CCCTGAAAACAGAGAGAGAATGG + Intergenic
919246801 1:194998219-194998241 CCCTGAAAACAGAGAGAGAATGG + Intergenic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
919776094 1:201194839-201194861 CCTGGTAATAAGAAAAAGAATGG + Intronic
920122136 1:203666658-203666680 CCTGGTGAGCATAGGGAGAGAGG - Intronic
920401984 1:205681675-205681697 CGTGGCAAGCAGAGAGACTAGGG + Intergenic
920623966 1:207577905-207577927 TCTTGGAAGCAGAGGGAGAAAGG + Exonic
920636605 1:207710482-207710504 TCTTGGAAGCAGAGGGAGAAAGG + Intronic
921018882 1:211217907-211217929 CCTAGTAAACAGAGAAAGACAGG - Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921945529 1:220883640-220883662 CATGGGAAGCAGAAAGGGAAAGG - Intronic
922494798 1:226048102-226048124 CCTGGTAATGAGAGTGAGATGGG - Intergenic
924335687 1:242985056-242985078 ACTGGTAAGCACAGGAAGAAGGG + Intergenic
924462052 1:244268605-244268627 CCTGGGAGGCTGAGACAGAAAGG + Intergenic
924687461 1:246309487-246309509 CCTGGTAAACAGAGGAAGTAAGG - Intronic
924806765 1:247367505-247367527 CTTTGTAAGCAGAGTGAAAATGG + Intergenic
1063159916 10:3411795-3411817 TCTGGGAAGAGGAGAGAGAAGGG + Intergenic
1064079996 10:12300646-12300668 GCAGGCAAGCAGAGAGTGAAAGG + Intergenic
1064263895 10:13809016-13809038 CCTGGTCAGCACAGAGAGCCAGG + Intronic
1064526269 10:16260042-16260064 CCTGTTAAGCTAAGATAGAAAGG - Intergenic
1064828527 10:19434006-19434028 CCTGGAAAACAGAGAAAGACTGG + Intronic
1065452008 10:25869290-25869312 CGTGGTTAGTTGAGAGAGAAGGG + Intergenic
1065989018 10:30989333-30989355 CCTGATAAGAGTAGAGAGAAAGG + Intronic
1066431559 10:35356806-35356828 TCTGTTAAGGAGAGAGAGAGAGG - Intronic
1066512091 10:36111912-36111934 CCTGTTAAGCTGAGATGGAATGG - Intergenic
1067054734 10:43044029-43044051 CCTGGTAAGCAGGGGGAGTGTGG - Intergenic
1067277145 10:44845970-44845992 CCTGGTAAGCAGACAGTGCCAGG - Intergenic
1067791305 10:49289735-49289757 CCTGGGAAGGAGAGAGACACAGG - Intergenic
1068819229 10:61353732-61353754 CCTGGGAGGCAAACAGAGAAAGG - Intergenic
1069768348 10:70880796-70880818 CCTGGAAACCAGAGAGAAAGAGG + Exonic
1069844940 10:71364492-71364514 CACGGGAATCAGAGAGAGAAAGG + Intergenic
1070750035 10:78958581-78958603 CTTGGAGAGCAGAGAGAGCAGGG + Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071328444 10:84539091-84539113 GCTGGAAAGCAGAGAGATGAGGG + Intergenic
1071961546 10:90812711-90812733 GGTGGTATGGAGAGAGAGAATGG - Intronic
1072151391 10:92687863-92687885 AGTGGTACTCAGAGAGAGAAAGG - Intergenic
1072530065 10:96310526-96310548 TCTGGGAAGCAGAGAGGTAAAGG - Intronic
1072632375 10:97155263-97155285 CCTGGGAAGCAGAAAGTCAAGGG - Intronic
1072820285 10:98550118-98550140 ACTGGAACACAGAGAGAGAATGG - Intronic
1073195014 10:101683390-101683412 GCCGGAAAGCTGAGAGAGAAGGG - Intronic
1074244211 10:111671113-111671135 CCTGGTTAGGTGGGAGAGAATGG - Intergenic
1074570746 10:114621921-114621943 CCAGGTAAGCAGGGACAGAGGGG + Intronic
1075226892 10:120637755-120637777 GCTGGGAAGCAGACAGACAAGGG + Intergenic
1075903532 10:126062318-126062340 CCTGGTTACCAGGGAGAGAGTGG + Intronic
1076160991 10:128244217-128244239 CCTGGTAAAGAGAGAGAGTTTGG - Intergenic
1076961854 10:133769437-133769459 CCTGTAAATCAGAGAGATAAAGG + Intergenic
1078275748 11:9844233-9844255 CCTGGTAAGCAAAGCTAGACAGG + Intronic
1078324569 11:10369267-10369289 TCTGGTCAAAAGAGAGAGAATGG + Intronic
1078379557 11:10828269-10828291 CATGGCAATAAGAGAGAGAAGGG + Intronic
1078480086 11:11667945-11667967 CCTGGGACACAGATAGAGAATGG + Intergenic
1078906217 11:15690459-15690481 CTTGGCAAGGAGAGAAAGAAAGG - Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079381880 11:19945398-19945420 CCTGGGTAACAGAGAGTGAAGGG - Intronic
1080040583 11:27755397-27755419 CATGCTAAGCAGAGAGAATATGG - Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1081632266 11:44697733-44697755 CCTGGTCAGGAGTGAGAGGAAGG - Intergenic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1082835678 11:57648818-57648840 CCTGTGAAGCAGAGACTGAAAGG - Exonic
1082871241 11:57945145-57945167 CCTGGTGAGAAGAGAAAGAACGG - Intergenic
1084683637 11:70681197-70681219 GCTGAGCAGCAGAGAGAGAACGG - Intronic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1087983129 11:104642204-104642226 GCTGGGAAGCAGAGTGGGAATGG - Intergenic
1088443680 11:109900771-109900793 CCTGGTCAACAGAGCAAGAAAGG + Intergenic
1088526269 11:110759260-110759282 CCAGGAAAACAGAAAGAGAAAGG - Intergenic
1088536680 11:110868976-110868998 CTTGGAAAGGAGAGAGAGCAGGG + Intergenic
1088716987 11:112557263-112557285 TCAGGGAAGCAGGGAGAGAATGG - Intergenic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1088987835 11:114925699-114925721 CCTGGTACCCTGAGAGAGGAAGG + Intergenic
1089086329 11:115820328-115820350 CCAGGAAAGGAGAGAGAGATAGG + Intergenic
1089255256 11:117190601-117190623 CCTGTTGGGGAGAGAGAGAAGGG - Exonic
1089446522 11:118557148-118557170 CCTCGTCACCAGAAAGAGAAGGG + Intronic
1089866555 11:121637878-121637900 GGTGGTATGGAGAGAGAGAATGG + Intergenic
1089954125 11:122555055-122555077 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1089988087 11:122832317-122832339 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1090227505 11:125080592-125080614 CCTGGAAGGGAGGGAGAGAAGGG - Exonic
1090652510 11:128819805-128819827 TCTGGCAAGCAGTTAGAGAAAGG + Intergenic
1090998082 11:131885157-131885179 CCCGGGAAGCAGAGAGGGTAGGG + Intronic
1091135896 11:133189062-133189084 CCATTTAACCAGAGAGAGAATGG - Intronic
1091559576 12:1601372-1601394 CCTGGGTAACAGAGAGAGAGAGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1093359252 12:18203132-18203154 GGTGGTATGGAGAGAGAGAATGG - Intronic
1094095106 12:26694894-26694916 CCTGGCAGTCAGACAGAGAAGGG + Intronic
1094713661 12:32990066-32990088 GAAGGAAAGCAGAGAGAGAAAGG - Intergenic
1094826546 12:34273664-34273686 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1095845132 12:46736376-46736398 CCTTATAAGCTGAGAGAGATTGG + Intergenic
1095989923 12:48027554-48027576 CCTCATTAGCAGAGACAGAAAGG + Intergenic
1095994536 12:48069212-48069234 CCAAGTAGACAGAGAGAGAAAGG + Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097285995 12:57877922-57877944 CATGAAAGGCAGAGAGAGAAGGG + Intergenic
1099405683 12:82259243-82259265 CCTGGTAAGCATAGCAGGAAAGG - Intronic
1100441056 12:94617228-94617250 CCTGATGAACAGAGAGAGAAAGG + Intronic
1100572848 12:95859073-95859095 GATGGTAAGGAGAAAGAGAACGG + Exonic
1100621591 12:96281229-96281251 CATTGTAAGGAGACAGAGAAAGG - Intronic
1100821494 12:98435832-98435854 CTTGGTGAGAAGAGAGGGAAAGG + Intergenic
1100968771 12:100043939-100043961 CCTGGGAAGCAGTGAGAAACAGG - Intronic
1101761742 12:107664395-107664417 CCTTTTAACCAGAGAGAGACAGG + Intergenic
1104828115 12:131729146-131729168 GCTGGTAAGAACAGGGAGAATGG + Intronic
1106152151 13:27115313-27115335 CCTGTTCTGGAGAGAGAGAAAGG + Intronic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1106418366 13:29565332-29565354 GATGGCCAGCAGAGAGAGAAAGG + Intronic
1107596219 13:41965435-41965457 ACTGGTTTGGAGAGAGAGAAAGG + Intergenic
1108678720 13:52761073-52761095 CCTGAGGAGAAGAGAGAGAAAGG + Intergenic
1108882667 13:55140142-55140164 CCTGGGAGACAGAGTGAGAAAGG + Intergenic
1109261375 13:60149046-60149068 CATGGTATTCAGAGAGACAAAGG + Intronic
1109736872 13:66497551-66497573 CCTGACAAGCTGAGAAAGAAAGG - Intronic
1109804798 13:67424913-67424935 ACAGGCAAGAAGAGAGAGAATGG + Intergenic
1110148404 13:72221598-72221620 CCTGCCAAGGAGGGAGAGAAAGG - Intergenic
1110765898 13:79279315-79279337 GATGGTATGGAGAGAGAGAATGG - Intergenic
1110845827 13:80189434-80189456 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1112717574 13:102204435-102204457 CCAGGAAAGCAGAGACAGCAGGG + Intronic
1112985632 13:105446013-105446035 CCTTGAAAGCTGGGAGAGAAAGG - Intergenic
1114680587 14:24480855-24480877 CTTGATAAGCAGTGTGAGAATGG - Intergenic
1115091824 14:29586250-29586272 TCTGGAATGCAGAGATAGAAGGG + Intronic
1116506950 14:45695125-45695147 CCAGGTTAGAAGAGAAAGAAGGG - Intergenic
1117477820 14:56115487-56115509 AATGGCAAGCAGAGAGAGCAGGG + Intergenic
1117664193 14:58039271-58039293 CCTGGAAAGGATAAAGAGAAGGG - Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118170292 14:63382157-63382179 CCTGGAAAGCACAGAAAAAAAGG + Exonic
1119189241 14:72669130-72669152 CCTGGTAGCCTGAGACAGAAAGG - Intronic
1119777358 14:77257396-77257418 CCTTGTAAGAATAGAAAGAAGGG - Exonic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1120585330 14:86305582-86305604 CCTCCTAGGAAGAGAGAGAATGG + Intergenic
1120699890 14:87687494-87687516 ACTGGTAACCAGAGAGCTAACGG - Intergenic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1121755544 14:96399376-96399398 AGTGGCAAGAAGAGAGAGAAGGG - Intronic
1122475804 14:102008156-102008178 CCTGGAAAGGAGAGGAAGAAAGG - Exonic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124075398 15:26439107-26439129 CCTGGTAAGGAGAGGGAGATGGG - Intergenic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125344651 15:38706832-38706854 TCTTGTAAGCAGTGAGAGACTGG + Intergenic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1128255102 15:66190547-66190569 CCTGGTAGGTAGAAAGGGAAAGG + Intronic
1128527487 15:68422376-68422398 CCTGGTCACCAGAGAAGGAAAGG - Intronic
1129085271 15:73083012-73083034 CCTGGAATGTAGTGAGAGAAGGG + Intronic
1129772713 15:78213026-78213048 CCCGCTGAGCAGAGAGAGATGGG - Intronic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1129858129 15:78839661-78839683 CCTGGTATGGAGAAAGAGAATGG + Intronic
1129941402 15:79500252-79500274 CCAGAGAAGGAGAGAGAGAAAGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130240825 15:82188603-82188625 CCTGGAAAGTAGATAGAGTAGGG - Intronic
1130537946 15:84800271-84800293 GCTGTGAAGCAGAAAGAGAATGG - Intronic
1130562404 15:84968906-84968928 CCGGGTAAGGGGAGAGGGAAAGG + Intergenic
1131343217 15:91622272-91622294 CCTGGTAATGAGACAGAAAATGG - Intergenic
1131400965 15:92125420-92125442 CCTGGGTAGAAGAGAGAGAAAGG + Intronic
1131403384 15:92144330-92144352 CCAGGGAAACAGAGAAAGAAGGG + Intronic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133526597 16:6611774-6611796 CTTGGGAAGCAGAGAGAGAAGGG - Intronic
1133869069 16:9671054-9671076 GGTGGTATGGAGAGAGAGAATGG + Intronic
1134605798 16:15570276-15570298 CCAGGTTAGCAGAAAGAGACTGG + Intronic
1135280520 16:21150534-21150556 CCTGGTAAAAAAGGAGAGAAAGG + Intronic
1135534961 16:23286732-23286754 CCTGGAAAAAGGAGAGAGAACGG + Intronic
1135674135 16:24401048-24401070 CCTGGAAAGGAGAGAGAGTGGGG + Intergenic
1136016966 16:27406518-27406540 CCTGGCTAGGAGAGAGAGATAGG + Intronic
1136093580 16:27937850-27937872 CCTGGTAATCAGAGACAGAGAGG - Intronic
1136141008 16:28288726-28288748 CCTGGTCAGCAGAGAGGGCAGGG - Intergenic
1137500278 16:49005655-49005677 ACTGGAGAGCAGAGTGAGAAGGG + Intergenic
1138557014 16:57776748-57776770 GTTGGTAAGCAGAGACAGAAAGG + Intronic
1138590868 16:57999095-57999117 CCTGTCACGCGGAGAGAGAATGG - Intronic
1139980940 16:70858435-70858457 ACTGGTCAGTGGAGAGAGAATGG + Intronic
1140312097 16:73859406-73859428 GCTGATAGGCAGAGAGAGACAGG - Intergenic
1140581487 16:76235643-76235665 CCAGGTACGGAAAGAGAGAACGG + Intergenic
1140992794 16:80230664-80230686 CCTGGTGAGCAGAGGCAGAGTGG + Intergenic
1140997298 16:80273324-80273346 ATAGGTAAGGAGAGAGAGAAGGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141799308 16:86296263-86296285 CCTGATAAGCAGAGTGAGTCTGG - Intergenic
1143040492 17:4032265-4032287 CGTGGTAGACAGAGACAGAAAGG + Intronic
1143861255 17:9892479-9892501 CCTGGGAAACAGAGTGAGACTGG - Intergenic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1145838889 17:27977301-27977323 CCTGGCAACCAAAGAGAAAAGGG + Intergenic
1146757918 17:35449341-35449363 CCGGGAAAGGAGAGAGAGATAGG - Intergenic
1147202537 17:38812709-38812731 CCTGGTAAGCTGAGAGTAAATGG + Intronic
1148020812 17:44552195-44552217 GATGGTAAGGAGAGAGAGTAAGG - Intergenic
1148957465 17:51365568-51365590 GCTGGTGCCCAGAGAGAGAAAGG - Intergenic
1150640601 17:66947141-66947163 CCTAGTTAGCAGAGCTAGAAAGG + Intergenic
1151218674 17:72594931-72594953 CCCTCTTAGCAGAGAGAGAAAGG - Intergenic
1151309991 17:73287105-73287127 CCTGGTCCTCAGAGAGAGAAGGG + Intronic
1152608379 17:81304034-81304056 CCTGGCATGCAGAGAGAGAAGGG - Intergenic
1152964429 18:101402-101424 CCTGTAAATCAGAGAGATAAAGG - Intergenic
1153338782 18:3952624-3952646 CATGGTAAGTGGAGAGAAAAGGG + Intronic
1153374476 18:4359733-4359755 AATGGCAGGCAGAGAGAGAAGGG + Intronic
1154949379 18:21193299-21193321 CTTGGTAAGAAGGGAGAGAGGGG + Intergenic
1155028106 18:21960685-21960707 CCTGGGAAAAGGAGAGAGAATGG - Intergenic
1155420900 18:25654902-25654924 CCTTATTAGCAGAGTGAGAATGG - Intergenic
1156501429 18:37562013-37562035 GGTGCTAGGCAGAGAGAGAAAGG - Intronic
1157339375 18:46765751-46765773 CTTGGTGAGCAGAGAGTGTAGGG - Intergenic
1158169755 18:54584665-54584687 CCTGGTAGGAAGAGAGAGAAGGG + Intergenic
1158473455 18:57759214-57759236 CTTGGAAAACAGAGAAAGAAAGG - Intronic
1160303820 18:77712489-77712511 CCAGGAGAGGAGAGAGAGAAAGG + Intergenic
1160929513 19:1563572-1563594 CCTGGCAAGCGGGGTGAGAAAGG + Intronic
1161076298 19:2287399-2287421 CATGGTAAGCAGAGTCAGACAGG + Intronic
1161947943 19:7450062-7450084 CCTGGTGAGCTGAGAAAGGAAGG + Intronic
1162791553 19:13065652-13065674 CCAGCAAAGGAGAGAGAGAAGGG - Intronic
1163738618 19:18997023-18997045 CATGGGAAGCAGGGTGAGAAGGG + Intronic
1165318542 19:35072399-35072421 CCTGCTCAGCAGAGAGAGGCTGG - Intergenic
1165843322 19:38802428-38802450 TCTGCTAAGCTGAGAGAGAATGG - Intronic
1166017044 19:39989592-39989614 ACTGGTAACCAAAGAGAGCAGGG + Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166346416 19:42168905-42168927 CCTGGTAAGGAGAGGAAAAAGGG - Intronic
1167798056 19:51723598-51723620 CCTGGGAGGCAGAGAGAAAGAGG - Intronic
1167963074 19:53123032-53123054 CCTGGGATCCAGAGAGGGAAAGG - Intronic
925344637 2:3162266-3162288 CCAGGAAAGGAGACAGAGAAAGG - Intergenic
925491577 2:4400944-4400966 CCTTATAAGGAGAGAGAGATTGG + Intergenic
927073067 2:19549632-19549654 CGAGGTAAGCAGAGTGAGAGAGG + Intergenic
927445620 2:23158599-23158621 CCTGTTCAGCACAGAGAGAGAGG - Intergenic
927998239 2:27501668-27501690 CCTGGAATGATGAGAGAGAATGG - Intronic
928277359 2:29915257-29915279 CCTGGGCAACAGAGTGAGAAAGG - Intronic
928742040 2:34366130-34366152 TCTGGGAGGGAGAGAGAGAAGGG + Intergenic
929411173 2:41698776-41698798 ACTGGCAAGAAGAGAGAAAAGGG + Intergenic
929551888 2:42898876-42898898 CCTGATAACCAGAGAGCAAATGG - Intergenic
931635538 2:64337972-64337994 CCTGGTAAGTAGATAGAGTAGGG - Intergenic
932088098 2:68780338-68780360 TCTGGTAAGGAGAGAAGGAAAGG - Intronic
932185060 2:69687430-69687452 CCTGGGAGGCAGAGATTGAAGGG + Intronic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
933259433 2:80115574-80115596 CATGGTAACGAGAGAGAGAGGGG + Intronic
933340453 2:81018757-81018779 AATAGTAAGCAGAGAGAGAAAGG - Intergenic
933389517 2:81652474-81652496 TCTGCTCAGCAGAGAGAGGATGG - Intergenic
933993940 2:87654133-87654155 CCTGGAAAGCAGGGTGAGAGGGG - Intergenic
933997864 2:87683117-87683139 CCTGGTAGGCAGTGATGGAAGGG + Intergenic
935101989 2:100005078-100005100 TCTGGTTAGCAGAGAGAGAGGGG - Intronic
935193320 2:100795494-100795516 GCTGGAAACCAGTGAGAGAAAGG - Intergenic
935638422 2:105268589-105268611 GCTGGGAAGCAGAGAGAGGTGGG + Intronic
936295986 2:111267749-111267771 CCTGGTAGGCAGTGATGGAAGGG - Intergenic
936299925 2:111296781-111296803 CCTGGAAAGCAGGGTGAGAGGGG + Intergenic
936656421 2:114493284-114493306 GATGGTGGGCAGAGAGAGAAAGG + Intronic
936781905 2:116043347-116043369 TCTGTTAAGAAGAGATAGAAAGG - Intergenic
937808641 2:126174910-126174932 CATGTTGAACAGAGAGAGAAGGG - Intergenic
937910693 2:127074182-127074204 CTGGGAAAGGAGAGAGAGAATGG - Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
939436369 2:142182653-142182675 CCTATTCAGCAGAGAGATAATGG + Intergenic
939722368 2:145669746-145669768 AATGGTAACTAGAGAGAGAATGG - Intergenic
939895527 2:147786524-147786546 CCTGATAAGCAGAGAAGGATGGG - Intergenic
940074844 2:149730024-149730046 CCTGGTAAGCAGCCATAGATAGG - Intergenic
941310331 2:163920914-163920936 ACTTGTAAGCTGAGTGAGAAAGG + Intergenic
941823422 2:169865647-169865669 GCTGGAAAGCAGAAAGAGAAAGG - Intronic
942458421 2:176152959-176152981 CCTGGTGCGCAGGGAGAGATGGG - Exonic
944455932 2:199894020-199894042 CCTGGAAAACAAGGAGAGAAAGG - Intergenic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945376583 2:209083831-209083853 GGTGGTATGGAGAGAGAGAATGG - Intergenic
945532002 2:210967272-210967294 CCTGGTAAGGAAAAAGAGAAGGG + Intergenic
945950128 2:216031379-216031401 CCTGGGCAACAGAGTGAGAAAGG + Intronic
946065762 2:216985928-216985950 CCTGGTAACCAGAGAGCCAGTGG - Intergenic
946711351 2:222510289-222510311 ACTGGTAAGCTGAGAAAAAAAGG + Intronic
947288382 2:228543760-228543782 CCTGTGAAGCAAAGAGAAAAAGG + Intergenic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
948115545 2:235492747-235492769 CCTGGTGAGCACTGGGAGAAGGG + Intergenic
948124186 2:235552824-235552846 CCGGCTCAGCAGAGAGAGATGGG - Intronic
948200718 2:236128102-236128124 ACTGGCAAGCTGAGAGAGGAGGG - Exonic
948240717 2:236431190-236431212 CCTGGGAAGGAGAGAGAAAAGGG - Intronic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
1169795474 20:9458323-9458345 CCAGTTAAGAAGAGAGAGAGTGG - Intronic
1169995032 20:11546797-11546819 CCTTGTAAGGAGTAAGAGAAGGG + Intergenic
1170036414 20:11994594-11994616 CCTGACAAAGAGAGAGAGAAAGG - Intergenic
1170680242 20:18519856-18519878 CATGGTCAGCAGGGAGAGCACGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1174831136 20:53813288-53813310 CCTGACAAGCAGAGAGAAAATGG - Intergenic
1174853810 20:54023571-54023593 TTTGATAAACAGAGAGAGAAAGG + Intronic
1175341579 20:58234111-58234133 CGTGGTCATCAGGGAGAGAAAGG + Intergenic
1176105649 20:63384601-63384623 CCTGGTAGAGAGGGAGAGAAGGG + Intergenic
1177120062 21:17127250-17127272 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1177261708 21:18737808-18737830 CTTGGGTAGCAGAAAGAGAAAGG + Intergenic
1177277060 21:18926241-18926263 CTTGGAAAGGAGAGAAAGAAAGG - Intergenic
1177688433 21:24470919-24470941 CACGGCAAGCAGAGAGAAAATGG + Intergenic
1177840297 21:26228366-26228388 GGTGGTATGGAGAGAGAGAATGG + Intergenic
1177996875 21:28111282-28111304 GCTGGTAAGCAAAGAGAAGACGG - Intergenic
1178672089 21:34600464-34600486 TCTAGGAACCAGAGAGAGAAGGG + Intronic
1178890412 21:36516093-36516115 CCAGGTGAGCACAAAGAGAAGGG - Intronic
1179067904 21:38043547-38043569 CCTGGAAAGCTAAGAGAAAATGG - Intronic
1179487178 21:41717763-41717785 CCTGCTTGGCAGAGAGAAAAGGG + Intergenic
1179992456 21:44955235-44955257 CTTGGAAAACAGAGAGAGACAGG + Intronic
1180716952 22:17878285-17878307 CCTGGGAAGAAGAGAGAAAGAGG + Intronic
1180934534 22:19616406-19616428 CGTGGCAAGAAGAGAGGGAAGGG - Intergenic
1181388194 22:22559404-22559426 CCTGGTAAGGGGAGAGGGACGGG + Exonic
1182137309 22:27918724-27918746 CCTGGTAACCAGCGGGAGATGGG - Intronic
1182438353 22:30345884-30345906 CCTGGGAAGAAGAGATAGAAGGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182940790 22:34275126-34275148 CCTGGTATGCAGAGATAAAAAGG - Intergenic
1184372093 22:44089137-44089159 CCAGGTAGGAAGAGAGAGACAGG - Intronic
1185011144 22:48315400-48315422 CCTGGAGCCCAGAGAGAGAAAGG + Intergenic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185344249 22:50304486-50304508 CCTGGTAGGCAGAGAAAGGCAGG + Intronic
949106719 3:208395-208417 ACTGGTGAGGAGAGACAGAAAGG + Intronic
949431905 3:3985865-3985887 CCATGTTAGCAGAGAGAGAAAGG - Intronic
949618077 3:5777582-5777604 AGTGGAAAGGAGAGAGAGAATGG - Intergenic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950392227 3:12705653-12705675 CCTGCAAAGGAGACAGAGAAGGG + Intergenic
950926909 3:16749519-16749541 GGTGGTATGGAGAGAGAGAATGG - Intergenic
951072423 3:18347175-18347197 GATGGTAGGCAGAAAGAGAAGGG + Intronic
951202298 3:19889119-19889141 CCTGGTAAGTAGGGGGAGGAGGG + Intronic
951549154 3:23859464-23859486 ACTGGTAAGCAGATAGATATGGG - Intronic
951817908 3:26775549-26775571 CCTGCTAAGGAAAGAGAGAAGGG - Intergenic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
952712035 3:36441241-36441263 ACTGGCAAGCACAGGGAGAAGGG - Intronic
952894769 3:38071011-38071033 GATGGTATGGAGAGAGAGAATGG + Intronic
953197355 3:40746862-40746884 CATGCTAAGCAGAGCTAGAAAGG + Intergenic
953197937 3:40751619-40751641 CCTGGAAAGCAGGAAGACAATGG + Intergenic
953413551 3:42702966-42702988 CCTGGGTAGCAGTGAGAGAGAGG - Intronic
954957967 3:54538564-54538586 CCAGGCAAGCAGAGAGAGAGAGG + Intronic
956576849 3:70761307-70761329 ACAGGCAAGCAGAGTGAGAAGGG + Intergenic
957434417 3:80154991-80155013 CCTGAGAAGAGGAGAGAGAAGGG - Intergenic
958121838 3:89300489-89300511 ACTAATAAGCAGAGAGAAAATGG + Intronic
958646239 3:96878301-96878323 CCTGGAAAATAGAGAGAGAGAGG + Intronic
962205995 3:133434439-133434461 GGTGGTATGGAGAGAGAGAATGG - Intronic
962898629 3:139737646-139737668 CATGTGAAGCAGAGAGAGCAGGG + Intergenic
962975358 3:140441568-140441590 GCTGGTAAGCAGAGAAGGCAGGG + Intronic
963636562 3:147804719-147804741 CCTGGACAGAAGACAGAGAAAGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963957156 3:151266769-151266791 CCTGGTAAGAAGAAAGACTAAGG + Intronic
964276113 3:155010638-155010660 CCTGTGAAGGAGAGAGGGAATGG - Intergenic
964537471 3:157739388-157739410 CCTAGCAAGCAAAAAGAGAACGG - Intergenic
964763176 3:160153472-160153494 CCAGATAAGGGGAGAGAGAAAGG - Intergenic
965625702 3:170682329-170682351 GGTGGTATGGAGAGAGAGAATGG + Intronic
965671784 3:171155244-171155266 CCAGGGAAGCAGACATAGAAGGG + Intronic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966058926 3:175732330-175732352 TCTGTAAAGCAGAGAGAGATGGG + Intronic
966067633 3:175835673-175835695 GGTGGTATGGAGAGAGAGAATGG - Intergenic
966232434 3:177666360-177666382 GGTGGTATGGAGAGAGAGAATGG + Intergenic
967174796 3:186853242-186853264 CCTGGTGAGAAGGGTGAGAAAGG + Exonic
968341227 3:197957560-197957582 CCTGGGAGGCTGAGACAGAATGG - Intronic
968870695 4:3240592-3240614 CCTGAGAAGAAAAGAGAGAAGGG - Exonic
969201139 4:5607151-5607173 TCTCCTAAGCTGAGAGAGAAAGG + Intronic
969848613 4:9939125-9939147 CATGGTAATCAGAGAGGAAATGG - Intronic
970255933 4:14170477-14170499 GATGGTATGGAGAGAGAGAATGG + Intergenic
970533207 4:17003376-17003398 GGTGGTATGGAGAGAGAGAATGG - Intergenic
970697788 4:18697851-18697873 TCAGGGAAGAAGAGAGAGAAAGG + Intergenic
970938224 4:21600085-21600107 CTTGGTTAGCAGAGGGAGTAAGG - Intronic
972175352 4:36398208-36398230 CTTGGTCACCAGAGAAAGAAAGG + Intergenic
972354775 4:38269994-38270016 CCTGGGAAGCAGTGAGAATAAGG - Intergenic
973232169 4:47853600-47853622 TCTAGTAAGCAGAGAGCTAAAGG + Intronic
974474192 4:62358998-62359020 CGGGGTAAGAAGAGAGAGAGAGG + Intergenic
975124091 4:70762205-70762227 CTTGGGAGGCAGAGACAGAAGGG + Intronic
975769371 4:77704852-77704874 GCCACTAAGCAGAGAGAGAAAGG - Intergenic
976117921 4:81747977-81747999 CCTGGGAAGAATAAAGAGAAAGG - Intronic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977224848 4:94383410-94383432 GGTGGTATGGAGAGAGAGAATGG + Intergenic
977352583 4:95907214-95907236 CCTGGCAATGAGAGAGGGAATGG - Intergenic
977484519 4:97625334-97625356 CCTGGGCAACAGAGAGAGATTGG - Intronic
978763044 4:112375828-112375850 AATGTTAAGCTGAGAGAGAAAGG - Intronic
979241432 4:118450224-118450246 ACTGGTAAGCACAGGAAGAAGGG - Intergenic
979524266 4:121701264-121701286 CCTGGTATGCAGGCAGAGTAGGG - Intergenic
980548600 4:134303199-134303221 CCTGCTATGTAGAGAAAGAATGG - Intergenic
981151654 4:141385601-141385623 CCTTGGAAGCAGAGACAGAGTGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981351024 4:143729814-143729836 GCTGGGAAGCAGAGAGCCAAGGG - Intergenic
982348168 4:154384721-154384743 CCAGGGAAGCAGAGATTGAAGGG + Intronic
983258727 4:165432163-165432185 CATGGTATGAAGAGAGACAAGGG - Intronic
984098592 4:175461692-175461714 GGTGGTATGGAGAGAGAGAATGG + Intergenic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
984519336 4:180783362-180783384 TCTGGGAAACAGAGAGAAAAAGG - Intergenic
984789158 4:183598718-183598740 GAAGGTAAGGAGAGAGAGAAAGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985465085 4:190186918-190186940 CCTGTAAATCAGAGAGATAAAGG + Intergenic
986087506 5:4466067-4466089 CCTAGAAAAGAGAGAGAGAAGGG + Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986823537 5:11496116-11496138 CCAGGTAAGGAGAGACAAAAGGG - Intronic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988625613 5:32871454-32871476 CTGGGAAAGCAGAGATAGAAAGG + Intergenic
989189587 5:38657389-38657411 CATGGTGAGAAGAGAAAGAATGG - Intergenic
989578373 5:43009835-43009857 CATGGTAAGCAGATCTAGAAAGG - Intergenic
990312608 5:54554044-54554066 CCTGGTGAGCAGGCAGAGCATGG - Intergenic
990681643 5:58251198-58251220 CCTGGGCAGAAGAGAGGGAAGGG + Intergenic
991181423 5:63755793-63755815 CATGGTAGTCAGAGAGAAAAAGG + Intergenic
991274285 5:64825385-64825407 CGTGGTAAGCAGGGAGAGGTTGG + Intronic
991604207 5:68383976-68383998 CCTGAAAAGCAGTGAGGGAATGG - Intergenic
993482931 5:88447645-88447667 TCTGGTATGGAGAGAAAGAAGGG - Intergenic
993716886 5:91283696-91283718 GGTGGTGAGGAGAGAGAGAAGGG + Intergenic
993824099 5:92659774-92659796 CATGGTAAGTAGACAGAGATAGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994838370 5:104887056-104887078 CATCATAAGCAGAGAGAAAATGG - Intergenic
994852375 5:105072123-105072145 CCTGCAGAACAGAGAGAGAAAGG + Intergenic
995478226 5:112569322-112569344 CCCTCTAAGCAGACAGAGAATGG + Intergenic
995558504 5:113355679-113355701 CATGGTAAGAAGAGAGGGCAAGG + Intronic
995573517 5:113506156-113506178 CCTGGAAATAAGAAAGAGAATGG - Intergenic
995646865 5:114322296-114322318 TCTAGTAAGTAGAGAAAGAAAGG + Intergenic
996123520 5:119698733-119698755 CCTTGTAAGCCGGAAGAGAACGG - Intergenic
996192028 5:120556439-120556461 ACTGGAAAGCAGAGAAATAATGG - Intronic
996744979 5:126839854-126839876 GGTGGTATGGAGAGAGAGAATGG + Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997778538 5:136633796-136633818 CCTGGAGAGCAGAGTGAGACAGG - Intergenic
998061365 5:139121217-139121239 CCAGGTAAGCAGAAAAAAAATGG + Intronic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
998264498 5:140657763-140657785 CCTGGGAAGCAGAGAAAAATGGG + Intronic
998599784 5:143573706-143573728 GATGGTAGGCAGAGTGAGAAAGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
1000122673 5:158212196-158212218 CATGGTGGGCAGAGAGAGATGGG + Intergenic
1000639649 5:163686360-163686382 CCTGGCAAGCTCAGAGAGGAGGG + Intergenic
1001333937 5:170782705-170782727 CCGGGAAGGGAGAGAGAGAAAGG - Exonic
1002350904 5:178582957-178582979 CCTGGGAAGAAGGGAGTGAAAGG - Intronic
1002700422 5:181120600-181120622 CCTGGGCATCAGAGAGAGACTGG - Intergenic
1003146526 6:3514785-3514807 CCTGGGTAGCAGAGAGCGAGAGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1005406194 6:25490323-25490345 CCAGGCAAACAGAGAGAGAGAGG + Intronic
1005743870 6:28817908-28817930 CCTGGGCAACAGAGAGAGAAGGG + Intergenic
1005955376 6:30659834-30659856 CCTGGAGAGCAGAAAGAGATGGG + Exonic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1008036782 6:46753556-46753578 CCTGGTGAGAAGAGGGAAAAGGG + Intronic
1008699695 6:54084182-54084204 CCAGGTTAGGAAAGAGAGAAGGG - Intronic
1009703322 6:67212035-67212057 ACATGTCAGCAGAGAGAGAAGGG - Intergenic
1010644840 6:78374215-78374237 CCTTGCAAGCCAAGAGAGAATGG + Intergenic
1010859017 6:80881301-80881323 GCTGGGAAGGATAGAGAGAAGGG + Intergenic
1012497677 6:99852582-99852604 TCTGGGAGGCAGAGAGAGGAAGG - Intergenic
1012675570 6:102107660-102107682 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1013217943 6:108047256-108047278 CCAGGTAAGTAAAGAGGGAAGGG + Intronic
1013465651 6:110415088-110415110 GCTGGTCAGCTGAGAGAGAGTGG + Intronic
1013845462 6:114445267-114445289 CCTGTAAAGTAGAGAGGGAAGGG + Intergenic
1014353581 6:120375443-120375465 CCTGGTAAACACATAGGGAAAGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019275058 7:171784-171806 CCTGGAAAGCAGTGAGAGAAGGG - Intergenic
1021100671 7:16584260-16584282 CCTGGTGAGCAGTGACATAAAGG + Intergenic
1021341373 7:19466610-19466632 CCTGAAAAGCAGAGAGATACAGG - Intergenic
1021510172 7:21426514-21426536 CCAGGTAAGAAGTGAGACAATGG + Intergenic
1022807433 7:33836900-33836922 CCAGGAAAGGAGAGTGAGAAAGG + Intergenic
1023262341 7:38370531-38370553 CCAGGTGAGGACAGAGAGAAAGG - Intergenic
1023538630 7:41240689-41240711 TCTGGGAAGCAGTGAGAAAAGGG - Intergenic
1024077129 7:45827211-45827233 CCTGGTGAACAGGGAGGGAAGGG - Intergenic
1024550165 7:50556102-50556124 AATGGTAACCAGAAAGAGAAAGG + Intronic
1029475308 7:100779792-100779814 TCAGGGAAGCAGAGAGGGAAAGG - Intronic
1029505376 7:100960730-100960752 CCTGGAAAACACAGAAAGAAAGG - Exonic
1029535203 7:101154022-101154044 CCTGGAAAACAGAAAGACAAAGG - Intergenic
1030000065 7:105050266-105050288 CCTAGTAGGAAGAAAGAGAAGGG - Intronic
1030187662 7:106779530-106779552 TCAGGTAAGGAGTGAGAGAATGG - Intergenic
1030441245 7:109592337-109592359 GGTGGTATGGAGAGAGAGAATGG + Intergenic
1030697741 7:112604037-112604059 CCTGGGCAACAGAGAGAGATGGG - Intergenic
1031120198 7:117713517-117713539 GTTGGTGAGGAGAGAGAGAAAGG - Intronic
1031503218 7:122547762-122547784 AATTGGAAGCAGAGAGAGAAGGG + Intronic
1031657792 7:124379845-124379867 CCTGGGAAGAGGAGAGAGGAGGG + Intergenic
1032544020 7:132727148-132727170 AATGGTGAGCAGAGAGACAAAGG + Intronic
1033635021 7:143204324-143204346 GCTTGTATGGAGAGAGAGAAAGG - Intergenic
1034752505 7:153584025-153584047 CAAGGTCAGCAGGGAGAGAAGGG + Intergenic
1036176516 8:6543381-6543403 CCAGGAAAGCACAGAGAGAAGGG - Intronic
1038077154 8:24089214-24089236 CCTGGTAAACTGAGAAAGACGGG - Intergenic
1039312591 8:36334159-36334181 CCTGGGCAACAGAGAGAGACAGG - Intergenic
1042194480 8:66220806-66220828 CCTGTGAAGGAGAGAGAAAAGGG + Intergenic
1042374813 8:68038339-68038361 TCTGGGAAGCACAGAGGGAAAGG - Intronic
1042374819 8:68038389-68038411 TCTGGGAAGCACAGAGAGAAAGG - Intronic
1042637612 8:70895265-70895287 CCTGGTAAGCACAGAAACTAGGG - Intergenic
1043346913 8:79309036-79309058 ACTGGTGGGGAGAGAGAGAAGGG - Intergenic
1044100136 8:88124887-88124909 CTTCGTAAACAGAGAGAAAAAGG + Intronic
1044167872 8:89010333-89010355 CCTGCTAAACAGAGAGGGTATGG + Intergenic
1044648815 8:94473609-94473631 CCTGTGAAGGAGATAGAGAAGGG + Intronic
1045214543 8:100134252-100134274 CCTGGTTCTCAGAGAGAGCAAGG - Exonic
1045462176 8:102434717-102434739 ACTGGAAACTAGAGAGAGAAGGG + Intergenic
1045524905 8:102933329-102933351 CCTGGTGAGAAAAGAGAAAAAGG - Intronic
1045620563 8:103972694-103972716 GCTGATAAACACAGAGAGAAAGG - Intronic
1045669691 8:104536196-104536218 ACTGGAAAGAAGAGATAGAATGG - Intronic
1046485062 8:114876451-114876473 ACTTGTAAGTAGAGAGTGAAGGG + Intergenic
1046843069 8:118883012-118883034 ACTTGTAAGCAGAGGCAGAATGG + Intergenic
1048198966 8:132355632-132355654 GCTGGCAAGCAAAGAGAAAAAGG + Intronic
1048729383 8:137420468-137420490 CTTGGAAAAGAGAGAGAGAAGGG - Intergenic
1048846801 8:138609914-138609936 CCTGGGAAGCAGAGATCCAAGGG - Intronic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1055473432 9:76637045-76637067 CCTGGTAGGAAGATATAGAATGG + Intronic
1056320835 9:85433273-85433295 CCTGGGAAGCACAAAGAGACGGG + Intergenic
1056331865 9:85528024-85528046 CCTGCCTAGGAGAGAGAGAATGG - Intergenic
1056994287 9:91442265-91442287 CCTTGTAAGCCAAGAAAGAAAGG - Intergenic
1057164614 9:92915949-92915971 CCAGGGGAGAAGAGAGAGAAGGG - Intergenic
1057320973 9:94012225-94012247 GCTGGTAAGCATGGAGACAAAGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057948170 9:99348050-99348072 CCTGGGAAACAGAAAGAAAAAGG - Intergenic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1058985992 9:110208519-110208541 GCTGGCAAGCAGAGAGTGAGGGG - Intergenic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1059550300 9:115222342-115222364 CCTGGGAAGAACAGGGAGAATGG + Intronic
1059822180 9:117985566-117985588 CTTGATAAGCTGAGAGAGAAAGG - Intergenic
1060059379 9:120445483-120445505 CATGGGTTGCAGAGAGAGAATGG - Intronic
1060062766 9:120475833-120475855 CCTGGGGAGCAGAGACAGTAAGG + Intronic
1060165726 9:121412961-121412983 CCTGGGTGACAGAGAGAGAAAGG - Intergenic
1060520186 9:124290013-124290035 CCTGGTAAGGAGAGCGACACAGG + Intronic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1186155913 X:6726265-6726287 GCTGGGAAGCACAGAGAGCAGGG + Intergenic
1187292735 X:17970635-17970657 CATGGTTTGCAGAGAGAGTAGGG - Intergenic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1188063193 X:25626066-25626088 GCTTGAAAGCAGAGAGAGACTGG + Intergenic
1189480644 X:41389867-41389889 CCTGGGAAATAGAGAGAGAGTGG + Intergenic
1190998338 X:55634704-55634726 CCTGGTCAGGAGAGAGATCAGGG - Intergenic
1191087124 X:56580940-56580962 CCTTGAAAGCAGTTAGAGAAGGG - Intergenic
1193873424 X:86830505-86830527 CCTTGTAAGCAGACACATAAAGG + Intronic
1194767164 X:97855092-97855114 CCTGTAAATCAGATAGAGAAGGG + Intergenic
1194947847 X:100090717-100090739 CCAGGGAAGCAGTGAGTGAACGG + Intergenic
1195087403 X:101425368-101425390 TGTGGTTAGCAGAGAGAGGAAGG + Intronic
1195702420 X:107715459-107715481 CCTGGTAAGGAGAGGGACAGGGG + Intronic
1195958623 X:110361681-110361703 CATGGAAGGCAGATAGAGAATGG - Intronic
1196165956 X:112535807-112535829 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1196341299 X:114601799-114601821 GGTGGTATGGAGAGAGAGAATGG + Intronic
1196712486 X:118777461-118777483 TCTCCTAACCAGAGAGAGAATGG - Intronic
1196989379 X:121311439-121311461 CCTGGAGAGCAGTGAGGGAAGGG - Intergenic
1197026528 X:121756522-121756544 CCTGTTGACCACAGAGAGAAGGG + Intergenic
1198249701 X:134868128-134868150 CCTGGGCAGCAGAGTGAGACCGG - Intergenic
1198323767 X:135546114-135546136 CTTGGAAAGCAGAGTGAGAGAGG + Intronic
1198377630 X:136054979-136055001 CTTGGTCAGGTGAGAGAGAATGG + Intergenic
1198843843 X:140888176-140888198 CCTGATAGGCAGAAAGAAAATGG + Intergenic
1199016229 X:142819473-142819495 CCTGGGGAGCAGGGAGAGACAGG + Intergenic
1199371349 X:147053143-147053165 CCTGTTAGGCAAAGAGAGAGTGG + Intergenic
1199406321 X:147465543-147465565 GCTGGTAAAGATAGAGAGAAAGG + Intergenic
1201549294 Y:15202524-15202546 GCTGGGAAGCATAGAGAGCAGGG + Intergenic
1201937894 Y:19427139-19427161 GGTGGTATGGAGAGAGAGAATGG - Intergenic
1202162212 Y:21946644-21946666 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202229144 Y:22639729-22639751 CCTGGTTAGCAGAAATAGGAGGG + Intergenic
1202314010 Y:23556437-23556459 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202389147 Y:24352054-24352076 ACTGGTAAGCACAGGAAGAAGGG - Intergenic
1202481640 Y:25318070-25318092 ACTGGTAAGCACAGGAAGAAGGG + Intergenic
1202556792 Y:26114158-26114180 CCTGGTTAGCAGAAATAGGAGGG + Intergenic