ID: 915734145

View in Genome Browser
Species Human (GRCh38)
Location 1:158074146-158074168
Sequence TTTTGAGTGATCAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915734145_915734153 14 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734145_915734154 29 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167
915734145_915734152 9 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915734145 Original CRISPR TTTTGAGTGATCAGGGTGGC AGG (reversed) Intronic