ID: 915734152

View in Genome Browser
Species Human (GRCh38)
Location 1:158074178-158074200
Sequence CTTTAGAAGACATGAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 369}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915734149_915734152 2 Left 915734149 1:158074153-158074175 CCCTGATCACTCAAAAGGGATTA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734143_915734152 24 Left 915734143 1:158074131-158074153 CCCAGGATCTCAGCACCTGCCAC 0: 1
1: 0
2: 1
3: 58
4: 814
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734150_915734152 1 Left 915734150 1:158074154-158074176 CCTGATCACTCAAAAGGGATTAT 0: 1
1: 0
2: 2
3: 9
4: 92
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734140_915734152 29 Left 915734140 1:158074126-158074148 CCTCCCCCAGGATCTCAGCACCT 0: 1
1: 0
2: 14
3: 275
4: 2343
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734142_915734152 25 Left 915734142 1:158074130-158074152 CCCCAGGATCTCAGCACCTGCCA 0: 1
1: 0
2: 5
3: 117
4: 1204
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734145_915734152 9 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734144_915734152 23 Left 915734144 1:158074132-158074154 CCAGGATCTCAGCACCTGCCACC 0: 1
1: 0
2: 3
3: 66
4: 771
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734139_915734152 30 Left 915734139 1:158074125-158074147 CCCTCCCCCAGGATCTCAGCACC 0: 1
1: 0
2: 7
3: 52
4: 624
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734148_915734152 5 Left 915734148 1:158074150-158074172 CCACCCTGATCACTCAAAAGGGA 0: 1
1: 0
2: 2
3: 9
4: 180
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369
915734141_915734152 26 Left 915734141 1:158074129-158074151 CCCCCAGGATCTCAGCACCTGCC 0: 1
1: 0
2: 2
3: 61
4: 890
Right 915734152 1:158074178-158074200 CTTTAGAAGACATGAATGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915734152 Original CRISPR CTTTAGAAGACATGAATGAA AGG Intronic