ID: 915734153

View in Genome Browser
Species Human (GRCh38)
Location 1:158074183-158074205
Sequence GAAGACATGAATGAAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 297}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915734149_915734153 7 Left 915734149 1:158074153-158074175 CCCTGATCACTCAAAAGGGATTA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734143_915734153 29 Left 915734143 1:158074131-158074153 CCCAGGATCTCAGCACCTGCCAC 0: 1
1: 0
2: 1
3: 58
4: 814
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734142_915734153 30 Left 915734142 1:158074130-158074152 CCCCAGGATCTCAGCACCTGCCA 0: 1
1: 0
2: 5
3: 117
4: 1204
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734144_915734153 28 Left 915734144 1:158074132-158074154 CCAGGATCTCAGCACCTGCCACC 0: 1
1: 0
2: 3
3: 66
4: 771
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734150_915734153 6 Left 915734150 1:158074154-158074176 CCTGATCACTCAAAAGGGATTAT 0: 1
1: 0
2: 2
3: 9
4: 92
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734148_915734153 10 Left 915734148 1:158074150-158074172 CCACCCTGATCACTCAAAAGGGA 0: 1
1: 0
2: 2
3: 9
4: 180
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297
915734145_915734153 14 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734153 1:158074183-158074205 GAAGACATGAATGAAAGGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915734153 Original CRISPR GAAGACATGAATGAAAGGTC AGG Intronic