ID: 915734154

View in Genome Browser
Species Human (GRCh38)
Location 1:158074198-158074220
Sequence AGGTCAGGTCAGCAGACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915734145_915734154 29 Left 915734145 1:158074146-158074168 CCTGCCACCCTGATCACTCAAAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167
915734148_915734154 25 Left 915734148 1:158074150-158074172 CCACCCTGATCACTCAAAAGGGA 0: 1
1: 0
2: 2
3: 9
4: 180
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167
915734149_915734154 22 Left 915734149 1:158074153-158074175 CCCTGATCACTCAAAAGGGATTA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167
915734150_915734154 21 Left 915734150 1:158074154-158074176 CCTGATCACTCAAAAGGGATTAT 0: 1
1: 0
2: 2
3: 9
4: 92
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167
915734151_915734154 -2 Left 915734151 1:158074177-158074199 CCTTTAGAAGACATGAATGAAAG 0: 1
1: 0
2: 0
3: 42
4: 388
Right 915734154 1:158074198-158074220 AGGTCAGGTCAGCAGACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915734154 Original CRISPR AGGTCAGGTCAGCAGACTTG AGG Intronic