ID: 915734156

View in Genome Browser
Species Human (GRCh38)
Location 1:158074217-158074239
Sequence GAGGAGCCACTCATGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915734151_915734156 17 Left 915734151 1:158074177-158074199 CCTTTAGAAGACATGAATGAAAG 0: 1
1: 0
2: 0
3: 42
4: 388
Right 915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915734156 Original CRISPR GAGGAGCCACTCATGGAGTA TGG Intronic
905263374 1:36734523-36734545 GAGGAGTTCCTCATGGAGAAAGG - Intergenic
909465971 1:75974418-75974440 TTGGAGCCACCCATGGAGGAAGG - Intergenic
913480728 1:119286686-119286708 AAGGATCCAGTCAAGGAGTATGG + Intergenic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
919757739 1:201076349-201076371 GAGGTGTCACTCATGAAATATGG + Intronic
921828679 1:219702617-219702639 GAGGAGCCATCCATGGAGGATGG - Intronic
924353221 1:243139854-243139876 GAGGAACCATTCAGTGAGTAGGG - Intronic
1064003899 10:11685096-11685118 GAGGAGCCCCTGATGGAGCCGGG - Intergenic
1073080258 10:100855221-100855243 GAGGAGGAATTCATGGAGAAAGG - Intergenic
1074183341 10:111081830-111081852 GAATAGCCACTTATGGAGGAGGG + Intergenic
1076265137 10:129103848-129103870 GAAGACTCACTCATAGAGTATGG + Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1087393277 11:97566819-97566841 GGGGACCCAGTCATGGAGGATGG + Intergenic
1088902193 11:114126778-114126800 GAGAAGCCACTCATGGCCTGAGG + Intronic
1090589349 11:128248657-128248679 TAGGTGCCACTCATAGAGGAAGG + Intergenic
1091032274 11:132201297-132201319 GAGAAGCAACTAATGGAGTCTGG + Intronic
1091372396 11:135071981-135072003 GAGGAGCCACTCATGAACACAGG - Intergenic
1092227820 12:6759935-6759957 GAGGAGGCACTCAAGGAATGAGG + Intronic
1095180005 12:39136477-39136499 AAGTACCCACTCTTGGAGTATGG + Intergenic
1099317959 12:81108011-81108033 GAGTCTCCACTCATGGAGGAAGG + Intronic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1101211763 12:102542064-102542086 GAAGAGCCACTTATGGAGATGGG + Intergenic
1106876672 13:34082035-34082057 AAGGAGCCTCTCATCAAGTAGGG + Intergenic
1107929694 13:45296982-45297004 GAGGATCCACGCATGGAGTGAGG + Intergenic
1107988496 13:45796747-45796769 GAGGAGCCATTCATTCAGTGAGG - Intronic
1110495315 13:76161344-76161366 CTGGAGTCAGTCATGGAGTAAGG - Intergenic
1111904282 13:94237565-94237587 AAGGAGCCACTCATTGAACAAGG + Intronic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1123983801 15:25626430-25626452 CAGCAGCCACTCATGGGTTAAGG - Intergenic
1124429355 15:29592915-29592937 GAGCTTCCACTCATGGTGTAAGG - Intergenic
1125628919 15:41131877-41131899 GTGGAGCTCCTCATGGAGTGAGG - Intergenic
1126072732 15:44879958-44879980 GAGGAGACTCCCATGGAGGATGG - Intergenic
1127360233 15:58238673-58238695 GAGGAGCCTCTCAGGTAGGAAGG + Intronic
1127766221 15:62187711-62187733 TTGCAGCCACTCATGGATTAGGG + Intergenic
1128455947 15:67831510-67831532 GAGGAGCCTCTCCTGGAGGAGGG + Intronic
1129090475 15:73144444-73144466 GTGGAGCATCTCATGGAGTTGGG - Intronic
1129993513 15:79985039-79985061 GAGAAGCTGCTCATGGAGAATGG + Intergenic
1129993658 15:79986250-79986272 GAGAAGCTGCTCATGGAGAACGG + Intergenic
1132067777 15:98746533-98746555 GGGAAGACACTCATGGAGCAGGG - Intronic
1141199021 16:81882969-81882991 GAGGAGCCCCTCCAGGAGTGTGG - Intronic
1142384861 16:89757319-89757341 CAGGAGGCATTCTTGGAGTAGGG + Intronic
1146486320 17:33245846-33245868 GAGGAAGCACTAATGGAGGAAGG + Intronic
1149339862 17:55674190-55674212 GAGGAGCCACAAAAGGGGTAGGG - Intergenic
1149651662 17:58279790-58279812 GAGGAGTCACTAGTGGAGCAGGG + Intronic
1152107244 17:78337800-78337822 GAGGGCCCACACAGGGAGTAGGG - Intergenic
1153188684 18:2514620-2514642 GAGTAGGAACTCACGGAGTAGGG - Intergenic
1156367860 18:36446321-36446343 GAGGAGCCAGCCACGGAGTCAGG + Intronic
1159650847 18:70975679-70975701 GAGGAGCAGCTCATGAAGTAGGG + Intergenic
1161516810 19:4701027-4701049 GAGCAGGCACTCGCGGAGTATGG + Intronic
1161634354 19:5377830-5377852 GGTGAGCCACTCATGGTGGAGGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1165742207 19:38211095-38211117 GAGGGGGCACTCCTGGATTAGGG + Intronic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
926611533 2:14952909-14952931 GAGAAGCAACTCAGGGAGTCTGG + Intergenic
929424742 2:41832576-41832598 GAGGAGCCAGGCAGGGAATATGG - Intergenic
931628383 2:64277185-64277207 GAGCAGCCTCTCATGGACTCTGG + Intergenic
932817553 2:74874083-74874105 GAGCAGGGACTCATGGAGTTGGG + Intronic
935371868 2:102355947-102355969 GAGGAGCCGGTCCTGGAGCACGG + Exonic
935733399 2:106085194-106085216 GAGCAGCCACTCATGGGGCCTGG - Intergenic
936266780 2:111016915-111016937 GAAGGGCCAGTCATGGAGTTGGG + Intronic
937903568 2:127040600-127040622 GAAGAGCCACTCACTGAGGATGG - Intergenic
939793715 2:146615157-146615179 GAGAAGCCACTTATTAAGTAAGG + Intergenic
945303332 2:208235035-208235057 GAGGAGATTCTCATGAAGTAGGG - Intergenic
947366983 2:229406712-229406734 GAGGAGCCACTCCTAGATTGGGG - Intronic
1169376965 20:5073958-5073980 GAGCTGCCACTCATGGTGGAAGG + Intronic
1171011253 20:21510609-21510631 AAGGAGCCACTCATAGATTTGGG + Intergenic
1171495604 20:25552966-25552988 GGTGAGGCACTCATGGAGTGGGG + Intronic
1173013122 20:39200413-39200435 GAGTGGCCACTGATGGAGTACGG + Intergenic
1174781966 20:53397967-53397989 GAGGGGCCTGTCATGGAGTGGGG + Intronic
1174916916 20:54663240-54663262 CAGAAGCCACTTCTGGAGTAAGG + Intergenic
1175330159 20:58158125-58158147 GAGGTGCCCCTCCTGGAGGATGG + Intronic
1176243598 20:64086235-64086257 GGGGAGTCACGCAGGGAGTAGGG + Intronic
1178668826 21:34572467-34572489 GAGCAGCCCCTCATGAAGTAGGG - Intronic
1181098078 22:20519870-20519892 GAGGAGGCCCCCAGGGAGTATGG - Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1184021394 22:41824176-41824198 GAGCAGCCCCTCAGGGAGTCAGG + Intronic
1184088700 22:42281402-42281424 GGGGAGCCACTTGTGGAGGAAGG - Intronic
1184940825 22:47763587-47763609 AAGGAGCAACTCATCGAGCAGGG - Intergenic
951857162 3:27210359-27210381 GAGGATCCATTCATGGATTAAGG - Intronic
954764202 3:52898963-52898985 GAGGAGCAGTTCATGGAGCAGGG - Intergenic
959687052 3:109158918-109158940 GGGAAGACACTAATGGAGTAAGG + Intergenic
963743241 3:149099924-149099946 GAGTAGCCACTCCTGCAGCATGG + Intergenic
965398219 3:168186451-168186473 GAGGATCCGCTCAGTGAGTATGG + Intergenic
968503473 4:961507-961529 GAGAAGCCACGCATGGACGACGG - Exonic
971309691 4:25514862-25514884 GAGGAGCCTCCCATGGTGTCTGG + Intergenic
972167606 4:36306792-36306814 GAGTAGCCACTCATAGAGACAGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974291875 4:59943699-59943721 CAGGAGCCACTGATGAAATATGG - Intergenic
979676219 4:123413054-123413076 GAGGAGCCAGTCATGGAAAGTGG + Intergenic
990616839 5:57517246-57517268 GAAGAGAAACACATGGAGTAAGG + Intergenic
992457730 5:76931394-76931416 GAGGAGCCAGTCATGGTGGCTGG - Intergenic
994661772 5:102662439-102662461 GAGGAGCCACTCAAGGTGTTAGG - Intergenic
997720814 5:136077145-136077167 GAGGAGCCAAACAGGGAGCAGGG + Intergenic
998994606 5:147857195-147857217 GAGTTGGCACTCATGGACTAAGG + Intergenic
1000017820 5:157293890-157293912 GGGGATCCAGTCATGGAGTGTGG + Intronic
1002461718 5:179377163-179377185 GAGAAGCCCCTCAGGGAGCAAGG + Intergenic
1005401566 6:25439480-25439502 GAAGAGCCACAAATGGAGTTGGG + Intronic
1005418134 6:25622837-25622859 GGGGTGCCGCTCATGGAGCAAGG + Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1011366350 6:86586408-86586430 GGGGAGCCACTGATAGGGTACGG + Intergenic
1011834465 6:91413939-91413961 GAGGAGATTCTCATGGATTATGG + Intergenic
1012496981 6:99844367-99844389 CAGGGGCCACTTTTGGAGTAGGG + Intergenic
1013675629 6:112458481-112458503 GAGCAGCCACGCATGGAGGGAGG - Intergenic
1019543957 7:1564097-1564119 GGGGAGCCACTCACGGGGTGAGG + Intergenic
1020140471 7:5608766-5608788 GAGGAGCCACCCTCGGGGTATGG - Intergenic
1023350462 7:39315570-39315592 GAGGGGCCACTCAGATAGTAAGG - Intronic
1023905191 7:44516880-44516902 GAAGAGCCCCTCAGGGAGGATGG + Exonic
1027434356 7:78148888-78148910 GAGGAGCCACTAATGGATTATGG + Intronic
1030111633 7:106031671-106031693 GAGAGGCCACTCATGCTGTATGG + Intronic
1031071328 7:117165271-117165293 GAGAAGCCAGTCATGGGATAGGG - Intronic
1031327408 7:120418798-120418820 GTACAGCCACTCATGGAGTGGGG - Intronic
1031408215 7:121411014-121411036 GAGGACCCACTCATCAAGTTCGG + Intergenic
1032263163 7:130352398-130352420 GATGAGCGACTGATGGAGTGAGG + Intronic
1035058799 7:156053766-156053788 GGATAGACACTCATGGAGTAGGG + Intergenic
1035159965 7:156943272-156943294 CAGCAGCCACTCAGGGAGCACGG + Intergenic
1035736397 8:1890295-1890317 GAGGAGACACTGATGGGGTGAGG + Intronic
1040081331 8:43289167-43289189 GAGGATCTGCTCCTGGAGTAAGG - Intergenic
1045542347 8:103098956-103098978 CAGGTGCCACTCTTGGAGGACGG + Intergenic
1046545631 8:115646584-115646606 GAGGAGCAAGTCCTAGAGTATGG - Intronic
1047722043 8:127650014-127650036 GAAGACCCACTCATTGAGTTTGG + Intergenic
1056363959 9:85884561-85884583 GTGGATCCCCTCATGGAGTGAGG + Intergenic
1056658110 9:88525217-88525239 GAGGGGCCATTCATGGGGTTTGG + Intergenic
1057425571 9:94946843-94946865 GAGGCGCCACCCATGAAGCATGG + Intronic
1057835148 9:98438404-98438426 GAGGAGACATTCAAGAAGTAGGG + Intronic
1058210192 9:102158750-102158772 GTGGTGCCACTCATTTAGTAAGG + Intergenic
1195460054 X:105114461-105114483 TAGGAGCCACTCTTTGAGTCAGG + Intronic
1196612195 X:117727909-117727931 GAGGATCTACTCATGGAGACTGG - Intergenic
1198248511 X:134855912-134855934 GAGGGGCCCCTCATGGAATGAGG + Intergenic
1198839816 X:140844355-140844377 GAGGAGGCACTCCAGGAGGAGGG + Intergenic
1199851818 X:151729256-151729278 GAGGAGCCTCCCCTGGGGTATGG + Intergenic