ID: 915735262

View in Genome Browser
Species Human (GRCh38)
Location 1:158080635-158080657
Sequence TACACGCCTGGGCAAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915735262 Original CRISPR TACACGCCTGGGCAAACACC TGG Intronic
900137440 1:1124206-1124228 CACACACCTGGACACACACCTGG + Intergenic
903735635 1:25528474-25528496 CACAGGGCTGGGCAAGCACCAGG + Intergenic
908750402 1:67417050-67417072 TACACACCTGTGCCAACTCCTGG - Intronic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915735262 1:158080635-158080657 TACACGCCTGGGCAAACACCTGG + Intronic
915735463 1:158081890-158081912 CACACACCCGGGCACACACCTGG + Intronic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
923849659 1:237780049-237780071 TACCTGCCTGGGAAAACTCCAGG - Intronic
924429409 1:243984240-243984262 GACACTCCTGGGCAAATCCCTGG + Intergenic
1063102576 10:2963300-2963322 CACACACCTGGCCACACACCTGG + Intergenic
1065019525 10:21493412-21493434 TACAGGCGTGAGCAACCACCCGG - Exonic
1065450078 10:25848023-25848045 TACTGGCCTGGGCAGAAACCAGG + Intergenic
1075317497 10:121464699-121464721 TCCACGCCTATGCAAACACATGG - Intergenic
1075349230 10:121709064-121709086 TTTATGCCTGGCCAAACACCGGG + Intergenic
1090408842 11:126493775-126493797 GCCCCGCCTGGGCAAACACATGG + Intronic
1094216976 12:27952671-27952693 CATGGGCCTGGGCAAACACCTGG + Intergenic
1098811490 12:75099387-75099409 TACACAGCTGGGCAAGCAGCTGG - Intronic
1105208251 13:18241401-18241423 TCCACCCCTGAGCACACACCAGG + Intergenic
1111696077 13:91626333-91626355 TACATGCCTGAGCAAGGACCAGG - Intronic
1113167482 13:107458517-107458539 TGCACGCCTGGGCAAAGCCAAGG + Intronic
1113626243 13:111849951-111849973 TACAGTGATGGGCAAACACCAGG - Intergenic
1114613078 14:24054707-24054729 TCCACGCCGGATCAAACACCTGG - Exonic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1119779583 14:77269342-77269364 CACACCCCAGGGCTAACACCTGG - Intronic
1126667789 15:51090731-51090753 AACAGGACTGGGAAAACACCAGG - Intronic
1129986209 15:79922101-79922123 TACAGGCCTGGGCAAACCCAGGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1154016898 18:10626918-10626940 TACAGCCCTGGGCAAACCCTAGG + Intergenic
1156555940 18:38068393-38068415 TACAGGCCTGGGCATACAGTGGG - Intergenic
1166120565 19:40683961-40683983 GACCAGCCTGGGCAAACACAGGG - Intronic
927039392 2:19213040-19213062 TGCAGGCCTAGGCAAACACTTGG + Intergenic
932492802 2:72132427-72132449 GACCTGCCTGGGCAAGCACCTGG - Exonic
937148893 2:119672359-119672381 CACCCACCTGGGGAAACACCAGG + Intergenic
947473274 2:230416717-230416739 AACACTCCAGGGTAAACACCTGG + Intronic
948055093 2:235005141-235005163 GTGACACCTGGGCAAACACCTGG - Intronic
1170254669 20:14326976-14326998 TATAGTCCTGGGCAAACCCCAGG + Exonic
1173688364 20:44939760-44939782 TACACGAGAGGGCAAAGACCTGG - Intronic
1176166140 20:63674805-63674827 TACACCTCTGGACAAACACTGGG - Intronic
1176293025 21:5056192-5056214 CCCACGCCTGGGCAGCCACCTGG + Intergenic
1178899449 21:36587670-36587692 AACACGCCTGAGCTAAAACCAGG + Intergenic
1179492962 21:41753320-41753342 TGCAGGCCTGGGGAAGCACCAGG - Intronic
1179864235 21:44207458-44207480 CCCACGCCTGGGCAGCCACCTGG - Intergenic
1180758820 22:18183298-18183320 TCCACCCCTGGGCACACACCAGG + Intergenic
1180769107 22:18367089-18367111 TCCACCCCTGGGCACACACCAGG + Intergenic
1180777205 22:18495306-18495328 TCCACCCCTGGGCACACACCAGG - Intergenic
1180809925 22:18752615-18752637 TCCACCCCTGGGCACACACCAGG - Intergenic
1180826982 22:18870318-18870340 TCCACCCCTGGGCACACACCAGG + Intergenic
1181025878 22:20127418-20127440 GACAGGCCTGGACATACACCCGG - Intergenic
1181196068 22:21186867-21186889 TCCACCCCTGGGCACACACCAGG - Intergenic
1181213459 22:21306257-21306279 TCCACCCCTGGGCACACACCAGG + Intergenic
1181524155 22:23469567-23469589 TGCACCCCTGGGCACACACCGGG + Intergenic
1182228608 22:28819465-28819487 TCCATGCCTGGGCAACCTCCAGG - Intergenic
1183883332 22:40856196-40856218 TACACCCCTGGGCAACCTCAGGG + Intronic
1203230730 22_KI270731v1_random:107974-107996 TCCACCCCTGGGCACACACCAGG + Intergenic
1203277124 22_KI270734v1_random:96223-96245 TCCACCCCTGGGCACACACCAGG + Intergenic
949925087 3:9034548-9034570 TACATGCATGGGCAAAAACCAGG + Intronic
950698150 3:14720473-14720495 TAGACCCCTGGGCAAGCAACTGG + Intronic
960668859 3:120137515-120137537 CACACTCCTGGGCAGACACCAGG - Intergenic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
962495098 3:135931675-135931697 GACAAGCCTGGGCAAACATAAGG - Intergenic
965707655 3:171525330-171525352 TCCAGGCCTGGGCAAACACATGG + Intergenic
969585170 4:8087447-8087469 TACACACCTGGCCTAACTCCTGG + Intronic
974661023 4:64888737-64888759 TACAATGCTGGGCAAAGACCAGG - Intergenic
975639912 4:76490139-76490161 CACACTCCTGTGCAAACATCTGG + Intronic
982530667 4:156538777-156538799 TTCACTCCAGGGCAGACACCAGG + Intergenic
986190048 5:5487976-5487998 GACAGACCTGGGCAAACAGCAGG - Intronic
993353718 5:86880907-86880929 TACTGGCCTGTGCAAACACTAGG - Intergenic
999362564 5:150998269-150998291 TACACTCTTAGGCAAACGCCTGG + Intergenic
1002834986 6:858211-858233 CACACTCCTGGGCATACATCAGG + Intergenic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1007817183 6:44532887-44532909 TCCACTCCTGGGCAGACAGCAGG + Intergenic
1011825609 6:91302199-91302221 TTCACTCCTGGGCATAGACCAGG - Intergenic
1018621606 6:165734269-165734291 GACACGCCTGGGCCACCTCCAGG + Intronic
1019666454 7:2254399-2254421 TCCAGGCCTGGGCACACACAGGG + Exonic
1040384766 8:46906915-46906937 TTCTCCCCTGGGCAGACACCTGG + Intergenic
1042408459 8:68433657-68433679 TACACGAATGGGTAAACACCAGG + Intronic
1046956493 8:120067829-120067851 GACAGGCCTGGGGAACCACCTGG - Intronic
1047044715 8:121039061-121039083 AACACGCCTGGGCAAAGAATGGG + Intergenic
1050858792 9:10396987-10397009 TACACGTCTGGGGAAACTACAGG + Intronic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1057000573 9:91504979-91505001 TACACTCCTGGGCTAGCCCCTGG - Intergenic
1059438692 9:114290722-114290744 TCAACGCCTGGGCAAACCCTGGG - Intronic
1061417208 9:130453588-130453610 TAGACCCCTGGGCTACCACCTGG + Intronic
1185492794 X:531746-531768 TACACACCTGGGCAGAGGCCTGG - Intergenic
1185735369 X:2491807-2491829 CACACACCTGTGCAAACATCAGG + Intronic
1186506457 X:10097011-10097033 AACATGGCTGGGCAACCACCTGG + Intronic
1187561945 X:20411647-20411669 TGCTTGCCTGGGCATACACCTGG + Intergenic
1188646537 X:32575274-32575296 TACACGCATGGGTAAACAGAAGG + Intronic
1191854143 X:65609194-65609216 GACAGGCCTGGGCAAAAACCAGG + Intronic