ID: 915735508

View in Genome Browser
Species Human (GRCh38)
Location 1:158082120-158082142
Sequence CAGAACAAGGAGGAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 636}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915735500_915735508 12 Left 915735500 1:158082085-158082107 CCTGTCCCCATCTGGCATTGGAA 0: 1
1: 0
2: 0
3: 7
4: 147
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735492_915735508 30 Left 915735492 1:158082067-158082089 CCCATCCCCATCCTCAAACCTGT 0: 1
1: 0
2: 0
3: 25
4: 336
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735498_915735508 19 Left 915735498 1:158082078-158082100 CCTCAAACCTGTCCCCATCTGGC 0: 1
1: 0
2: 1
3: 24
4: 249
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735494_915735508 25 Left 915735494 1:158082072-158082094 CCCCATCCTCAAACCTGTCCCCA 0: 1
1: 0
2: 3
3: 57
4: 482
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735495_915735508 24 Left 915735495 1:158082073-158082095 CCCATCCTCAAACCTGTCCCCAT 0: 1
1: 0
2: 1
3: 38
4: 306
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735502_915735508 6 Left 915735502 1:158082091-158082113 CCCATCTGGCATTGGAACCAGAT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735493_915735508 29 Left 915735493 1:158082068-158082090 CCATCCCCATCCTCAAACCTGTC 0: 1
1: 0
2: 3
3: 47
4: 466
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735503_915735508 5 Left 915735503 1:158082092-158082114 CCATCTGGCATTGGAACCAGATA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735496_915735508 23 Left 915735496 1:158082074-158082096 CCATCCTCAAACCTGTCCCCATC 0: 1
1: 0
2: 3
3: 44
4: 488
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636
915735501_915735508 7 Left 915735501 1:158082090-158082112 CCCCATCTGGCATTGGAACCAGA 0: 1
1: 0
2: 0
3: 14
4: 151
Right 915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG 0: 1
1: 0
2: 6
3: 75
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915735508 Original CRISPR CAGAACAAGGAGGAAGAGCC AGG Intronic
900241528 1:1619714-1619736 CCCAACAAGGGGGACGAGCCTGG - Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
902492442 1:16794298-16794320 CCCAGCAAGGAGGAAGAGCTGGG - Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904083764 1:27888911-27888933 CAGAACAATGAGGATTAGCAGGG + Intergenic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904292403 1:29496697-29496719 CAGAACAATAAGGAAGGGACAGG + Intergenic
904918371 1:33986489-33986511 CAGAGCGAGTAGGTAGAGCCAGG + Intronic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
906037041 1:42757243-42757265 CAGAGCTCGGAAGAAGAGCCTGG + Intronic
906519360 1:46458159-46458181 AAGAACAGGCAGCAAGAGCCTGG - Intergenic
906714392 1:47956108-47956130 CACAACAAGGAGGAAGCTGCTGG + Intronic
906935281 1:50209161-50209183 CTGAACAAGCAGGATTAGCCAGG - Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908786670 1:67741371-67741393 TAGCACAAGGAGGAACAGCTTGG - Intronic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
910191506 1:84600702-84600724 CAGAACAAGGCTGAAGGGGCAGG + Intergenic
910394022 1:86774031-86774053 CAGCACACTGAGGAAGAGCCAGG + Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912771797 1:112470933-112470955 CACACCAAGGAGGAAGCCCCTGG - Intronic
913250593 1:116909811-116909833 CAGGTAACGGAGGAAGAGCCGGG - Intergenic
915735476 1:158081942-158081964 CACACCCAGGAGGAAGATCCTGG - Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915839402 1:159202674-159202696 CAGACCAGGGAGGAAAAGCTGGG - Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917263419 1:173194464-173194486 CAGCACAAGGAGGAAAGACCTGG + Intronic
918090079 1:181283600-181283622 CAGAACAAGGAATAAAACCCAGG - Intergenic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919590501 1:199495895-199495917 TACACAAAGGAGGAAGAGCCAGG + Intergenic
920281077 1:204844101-204844123 TAGAATATGGAGCAAGAGCCAGG + Intronic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
922030563 1:221793647-221793669 TAGACCAAGCAGAAAGAGCCTGG + Intergenic
922272893 1:224050834-224050856 CAGAACAAGGAGGACCAGATGGG + Intergenic
922407965 1:225338472-225338494 CAGAACAAACAAGCAGAGCCAGG - Intronic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
923097652 1:230788375-230788397 CAGCAGGTGGAGGAAGAGCCTGG - Intronic
923421109 1:233816124-233816146 CAGAACCAGGAGGTAGAACCAGG + Intergenic
923528007 1:234788238-234788260 CCCAGCAAGGAGGAAGAGCTGGG + Intergenic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
924869749 1:248028208-248028230 CAGCTGAAGGAGGAAGAGACAGG - Intronic
1063604635 10:7511853-7511875 CAGAACACAGAAGCAGAGCCAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063746239 10:8885403-8885425 CAGAACAAAGAAGATGAGCAGGG + Intergenic
1065850427 10:29783131-29783153 AATAAAAAGGAGGAAGAGACAGG - Intergenic
1066048820 10:31617461-31617483 CAGACCAGGCAGGAAGAGCAGGG + Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066574495 10:36810683-36810705 CAGCACAAGGGAGAAGAGGCAGG + Intergenic
1069833725 10:71296028-71296050 CAGAGCTAGGAGGCAGGGCCCGG - Intronic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1070648283 10:78216545-78216567 CAGAAGAAAAAGGAAAAGCCTGG - Intergenic
1070687027 10:78492654-78492676 CAGAAAGAGGAGGCAGAGACTGG + Intergenic
1071589985 10:86863607-86863629 GAGAACCAGAAGGCAGAGCCAGG - Intronic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072535296 10:96357947-96357969 GAGAGGAAGGAGGAAGAGACAGG + Intronic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074615369 10:115062054-115062076 CAGTTGGAGGAGGAAGAGCCTGG - Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075439682 10:122469753-122469775 CAGTGCAAGGAGGCAGAGCCAGG + Intronic
1076031705 10:127164476-127164498 AAAAACAAGGAGGCAGGGCCGGG - Intronic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076286053 10:129297401-129297423 AATAACAAAGAGGAAAAGCCTGG + Intergenic
1076443829 10:130498351-130498373 CTGCTCAAGGAGGCAGAGCCAGG - Intergenic
1076450111 10:130551395-130551417 CACAACAGGGAGGCAGACCCAGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076803172 10:132841975-132841997 CAGCACAGAGAGGAAGGGCCGGG - Intronic
1077728028 11:4696275-4696297 ATGAAGCAGGAGGAAGAGCCAGG - Intronic
1077877227 11:6319215-6319237 CAGGACACCGAGGAAGATCCCGG - Exonic
1078154072 11:8783828-8783850 AAGAGCCAGGAGGAAGAGCAAGG + Intronic
1078255574 11:9655773-9655795 AAGAAAAAGGTGGAAGGGCCAGG + Intergenic
1079929944 11:26545790-26545812 TAGAGCAAGGAGGAAGAGGGAGG - Intronic
1081720066 11:45282146-45282168 TTGAGCAAGGAGAAAGAGCCAGG - Intronic
1082260028 11:50071626-50071648 CAGAAGGAAGAGGAAGAGCTGGG + Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083477130 11:62921837-62921859 CACAGCAGGGAGGAAGAGCAGGG - Intergenic
1084139469 11:67215460-67215482 CAGCACACGGAGGAAGATGCAGG - Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084694534 11:70745700-70745722 CAGAAGTAGGAGGCAGACCCTGG - Intronic
1084864085 11:72041594-72041616 CAGGGCAAGGAGGAAGACCCGGG + Intronic
1084890439 11:72234162-72234184 CAGAGCAAGGAGGCAGGGCCAGG - Intronic
1087190688 11:95251085-95251107 CAGGACATGTAGAAAGAGCCTGG + Intergenic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1087618213 11:100513071-100513093 CAGAACAAGGATTTAGAGTCAGG + Intergenic
1088548074 11:110981722-110981744 AAGAACAAGGCAGAAGAGGCAGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089337994 11:117738643-117738665 CAGACCAAGGAAGAAATGCCTGG - Intronic
1089973702 11:122714569-122714591 CAGAACCAGGAGTCAGAGCCAGG - Intronic
1090274751 11:125411520-125411542 AAGGACAAGGAGGAAGAGATGGG - Intronic
1090466445 11:126938924-126938946 CAGAACAAGTAGGATGAGACAGG + Intronic
1090626846 11:128615569-128615591 GAGAAGCAGGAGGGAGAGCCAGG + Intergenic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092195847 12:6549326-6549348 GAGAAAAAGGGGGAAGAGCAAGG + Intronic
1092653987 12:10665577-10665599 GAGAACCAGGAAGAAGATCCTGG + Intronic
1092740111 12:11620131-11620153 CAAAAAAACGAGGAAGGGCCAGG - Intergenic
1092989892 12:13886534-13886556 ATGAACAAGCAGGAAGGGCCAGG + Intronic
1094433647 12:30397793-30397815 CAGAGCCTGGAGGAAGAGCCAGG + Intergenic
1094480454 12:30877186-30877208 CTGAGCAAGGAGGAAGCCCCTGG + Intergenic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1096256470 12:50064987-50065009 CAGAACAAGGGGGAACATGCTGG + Intronic
1096707079 12:53429095-53429117 CAAAAGAGGGAGGAAGAGCCGGG + Intronic
1097223978 12:57466121-57466143 CACCTCAAGGAGGAAGAGGCAGG - Intronic
1098268746 12:68750038-68750060 CAGGACAGGCAGGAAGGGCCTGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098799159 12:74931332-74931354 CACAACAAGAAGGATGAACCTGG - Intergenic
1099231436 12:80030173-80030195 CAGAACAAGGAGGCTGGGCAGGG - Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1101822728 12:108196193-108196215 CGGGAGAAGGAGGAAGAGCGAGG + Exonic
1102461055 12:113099887-113099909 CGGAAGGAGGAGCAAGAGCCAGG - Exonic
1102727318 12:115077197-115077219 GAGAACAAGGAGGGAGTGCATGG - Intergenic
1102943549 12:116964767-116964789 GAGGACGAGGAGGATGAGCCTGG + Exonic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1104635599 12:130436477-130436499 CAGCAAAACCAGGAAGAGCCTGG + Intronic
1104895244 12:132160779-132160801 GTGATCAAGAAGGAAGAGCCGGG + Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1105890388 13:24678401-24678423 CGGAAGAAGGAGGGAGAGCGGGG + Intergenic
1106216500 13:27706585-27706607 CATAAGAGGGAGGCAGAGCCAGG - Intergenic
1106223663 13:27769106-27769128 CAGAAAAAGTAAGAAGAACCAGG + Intergenic
1106231604 13:27825228-27825250 CAGGACAGGGAGGCAGGGCCAGG + Intergenic
1106558261 13:30828469-30828491 CAGCACATGGAGGAAGCACCAGG - Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1107126415 13:36851302-36851324 CAGAAGAAGAGGGAAGAGCAAGG - Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107827975 13:44347432-44347454 AAAAAAAAGGAGGTAGAGCCTGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1112296222 13:98189137-98189159 CTTAACAAGGAGGAAGAGCCAGG + Intronic
1113279879 13:108777619-108777641 AAGAACAAGAAGGAACATCCTGG + Intronic
1113377838 13:109781906-109781928 CAAAACAAGGAGCCAGTGCCAGG + Intronic
1113792244 13:113035011-113035033 CGGGAAAAGGAGGAAGAGCATGG + Intronic
1114578571 14:23736133-23736155 CAGAGGAAGGAGGGAGAGCAAGG + Intergenic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114761903 14:25325332-25325354 CAGAAACAGAAGGAATAGCCTGG + Intergenic
1115257084 14:31414802-31414824 AGGAACCATGAGGAAGAGCCAGG - Intronic
1115308037 14:31951989-31952011 CAAAACAGGGAGGAAGAGAGGGG - Intergenic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116172081 14:41416045-41416067 CAGAATCAGAAGGAACAGCCTGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116479941 14:45385474-45385496 CGGAAGAAGGAGGAAGGTCCTGG + Intergenic
1117283604 14:54264757-54264779 CAGAATAGAGAGGAAGGGCCAGG + Intergenic
1117869935 14:60189756-60189778 CAGAAAAAGGAAGAAGGGACTGG - Intergenic
1118322466 14:64761380-64761402 CTGAACAGGGGGAAAGAGCCAGG + Intronic
1118335601 14:64851202-64851224 CAGTACAAGGATTAAGAGGCAGG + Intronic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1118742734 14:68752154-68752176 CTGATCAAGGAGGGAGAGCTTGG - Intergenic
1119224540 14:72934694-72934716 CAGGATAAGGATGAAGACCCAGG - Intronic
1119328868 14:73779088-73779110 TAGAACAAGAAGAAATAGCCGGG + Intronic
1119365271 14:74085729-74085751 CAGAACCAAGAGGAAAAGCATGG - Intronic
1119423155 14:74519928-74519950 CAGAACAGGCTGGAGGAGCCAGG - Intronic
1119947437 14:78709648-78709670 CAGATCAGGTAGGAAGAGGCAGG + Exonic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120645403 14:87068004-87068026 TAGGACAAGGACTAAGAGCCTGG - Intergenic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121082458 14:91119395-91119417 CAGATCAAGGTAGAAAAGCCTGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1121761775 14:96451181-96451203 CTGAACAAGTAGGAAGATACTGG - Intronic
1122009908 14:98737431-98737453 CAGAACAAAGAGGGAGAGTCAGG + Intergenic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122862466 14:104588710-104588732 CAGGACAAGGCCGAGGAGCCGGG - Exonic
1124322350 15:28724567-28724589 GTGACCAAGGAGGCAGAGCCTGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124831806 15:33156110-33156132 GAGAGAAAGGAGGAAGAGTCTGG + Intronic
1125105541 15:35967026-35967048 CATAACAAAGGGGAAGTGCCTGG - Intergenic
1125641310 15:41232534-41232556 CAGACTAATGAGGAAGAGACTGG - Intronic
1126191436 15:45883023-45883045 CAGAACCAGGAAGCAGACCCAGG - Intergenic
1127496070 15:59513322-59513344 AGGGACTAGGAGGAAGAGCCTGG + Intronic
1128335317 15:66781884-66781906 CAGAGCTAGGTGGAAAAGCCTGG + Exonic
1128441666 15:67715168-67715190 CAGAAAAGGGAGTAAGAGCAGGG - Intronic
1128727792 15:70000594-70000616 GAGAAGAAGCAAGAAGAGCCAGG + Intergenic
1128798611 15:70482410-70482432 CTGAACAAGGAGGGAGGGCATGG + Intergenic
1129034718 15:72642158-72642180 CAGCCCAAGGAGTAAGAGCCTGG - Intergenic
1129215164 15:74095058-74095080 CAGCCCAAGGAGTAAGAGCCTGG + Intergenic
1129732309 15:77939403-77939425 CAGCCCAAGGAGTAAGAGCCTGG + Intergenic
1130055858 15:80525320-80525342 CAGAACAAGGTGGCATAGCTAGG - Intronic
1130078374 15:80709691-80709713 GAGAACAATGAGGGAGAGGCCGG - Intronic
1130930925 15:88427255-88427277 TAGTACACAGAGGAAGAGCCAGG + Intergenic
1131045780 15:89314270-89314292 CAGAACAAGGAAATAGAGCTAGG + Intronic
1131226038 15:90624936-90624958 CAGAACTAGGGGGAAGAGAAGGG + Intronic
1131561762 15:93449807-93449829 CAGAACAAAGAGGCAGAGGATGG - Intergenic
1132352128 15:101146425-101146447 AAGAGGAAGGAGGAAGAGACAGG - Intergenic
1132750053 16:1453463-1453485 CAGACCAAGAAGGAAGAAGCCGG + Intronic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1134041324 16:11070723-11070745 AAGAGCAAGGAGGCAGAGACAGG - Intronic
1134913879 16:18052953-18052975 CAGAGAAAGAAGGAAGAGCAGGG - Intergenic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135979366 16:27135271-27135293 CAGAACAAGGGGGAAAAGGCCGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1138310995 16:56023901-56023923 CACAACTAACAGGAAGAGCCAGG + Intergenic
1138868981 16:60857996-60858018 GAGAAGGAGGAGGAAGAGCGGGG - Intergenic
1138985550 16:62323978-62324000 CAGAAGACAGAGGAAGAGCAGGG + Intergenic
1139380002 16:66524631-66524653 CAGAAGAAGGTGGCAGGGCCGGG - Intronic
1140122338 16:72094222-72094244 CAGAGCAAGGAGGAAGGCCAAGG - Intronic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1140631986 16:76864435-76864457 CAGAACAAGGTGGAATAAGCTGG + Intergenic
1140687279 16:77445534-77445556 CAGAGCAAGGAGGCAGAGCCAGG + Intergenic
1140774993 16:78241311-78241333 CAGACCAAGGAGGGAGAGAAAGG - Intronic
1141033603 16:80610110-80610132 CAGAACAAGGGGGAATATCAAGG + Intronic
1141342839 16:83218947-83218969 CAGAAGATGGAGGAAGAACAAGG - Intronic
1141651833 16:85396998-85397020 CAGAGCAAGGACCAAGAGACGGG + Intergenic
1142121151 16:88387316-88387338 CAGACCAAGGGGGGAGAACCGGG - Intergenic
1142554847 17:766934-766956 AAGAGCGAGGAGGAAGAGTCTGG + Intronic
1143545121 17:7591029-7591051 CTGAACCAGGAGGGAGAACCTGG + Intronic
1143632493 17:8147118-8147140 CAGGACAAGAAGGAAAAGGCAGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143870932 17:9956913-9956935 CAGAACCCAGAGGAAGAGGCTGG + Intronic
1144044043 17:11438953-11438975 CAGAGCAAGGATGAAGGGCAGGG + Intronic
1144198565 17:12918695-12918717 CAGCTGAAGGAGGAAGAGCGTGG - Intronic
1144348629 17:14372944-14372966 CGGAAGTAGGAGGAAAAGCCAGG + Intergenic
1145210722 17:21011238-21011260 CAGAATGGGGTGGAAGAGCCGGG + Exonic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1147012998 17:37466760-37466782 CAGAGAATGAAGGAAGAGCCTGG - Intronic
1147504212 17:40999254-40999276 CAGTACAAGAAACAAGAGCCAGG + Exonic
1147567793 17:41548234-41548256 CACCTCAACGAGGAAGAGCCAGG + Intergenic
1147970120 17:44214835-44214857 CGGGACAAGGAGACAGAGCCAGG - Intronic
1148208621 17:45794859-45794881 CAGAGGCAGGAGGCAGAGCCGGG - Intronic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148978530 17:51550526-51550548 CAGAAGTAAGGGGAAGAGCCAGG - Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1150484437 17:65533847-65533869 CAGAACCAAGAGCCAGAGCCTGG - Intronic
1151292914 17:73163472-73163494 CAGGAAAAGAAGGAAGAGCCAGG - Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152245311 17:79182321-79182343 CAGCGCCAGGAGGAAGAGACAGG + Intronic
1152534520 17:80942779-80942801 CAGGAGAAGGCTGAAGAGCCGGG - Intronic
1152754387 17:82081099-82081121 GACAACAAGGAGGAAGGGCTGGG + Intronic
1153910011 18:9698442-9698464 CAGAACCAGAAAGAAGGGCCAGG - Intergenic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1157366203 18:47066563-47066585 GAGATCAAGGAGCAAGAGCAAGG + Intronic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157446852 18:47752825-47752847 CAGAGCTGGGAGGAAGAACCAGG + Intergenic
1157551283 18:48583270-48583292 AAGGACAAGGAGGCAGAGCAGGG + Intronic
1157599755 18:48886726-48886748 AAGACCAAGGAGGAAAGGCCAGG + Intergenic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158164203 18:54520594-54520616 CAGTAGATGGAGGAAGATCCTGG - Intergenic
1159000610 18:62971601-62971623 CAGCACAGGGAGGAAGACCCAGG - Intronic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1160011304 18:75108781-75108803 CAGACCAAAGAGGCAGAGCTGGG - Intergenic
1160526838 18:79543371-79543393 CAGGACAAGAAGGGACAGCCTGG - Intergenic
1161009923 19:1955095-1955117 ATCACCAAGGAGGAAGAGCCCGG - Intronic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161373392 19:3926431-3926453 CAGAGCTAGGAAGAAGGGCCTGG - Exonic
1161678408 19:5666468-5666490 CAGAGCAAGGTGCAAGACCCTGG + Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1163666240 19:18605383-18605405 CAGCACAGGGTGGATGAGCCTGG + Intronic
1164521990 19:28986403-28986425 GAGAAAATAGAGGAAGAGCCTGG + Intergenic
1164800072 19:31068877-31068899 AGGAACAAGGAGGAACACCCTGG + Intergenic
1165256692 19:34580546-34580568 CAGGGCAGGGAGGAAGAGACAGG - Intergenic
1165265894 19:34663847-34663869 CAGGGCAGGGAGGAAGAGACAGG + Intronic
1165273534 19:34730878-34730900 TAGGGCAAGGAGGAAGAGACAGG + Intergenic
1165386211 19:35511979-35512001 AAAAAAAAGGAGGAAGAGACGGG - Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166778222 19:45325120-45325142 CAAAACAAGGAGGCTGAGGCAGG + Intergenic
1166996941 19:46723950-46723972 ATGATCAAGGAGGCAGAGCCGGG + Intronic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167709348 19:51100312-51100334 TTGAAAATGGAGGAAGAGCCGGG + Intronic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
925599505 2:5593398-5593420 CTGAGCAGGGAGGCAGAGCCAGG - Intergenic
925945172 2:8855360-8855382 CAGAACCAGAATGAAGATCCAGG + Exonic
926108546 2:10167622-10167644 AGACACAAGGAGGAAGAGCCAGG - Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926676980 2:15633097-15633119 CAGAACAAGGCAGAGGAACCTGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927879209 2:26678863-26678885 CAGAAGAAGGTGGAAGAAACTGG + Intergenic
929151311 2:38751353-38751375 CGGCACTACGAGGAAGAGCCCGG + Exonic
930444647 2:51454758-51454780 AAGAACAAAGAGGCAGAGACAGG - Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931205232 2:60140085-60140107 GAGAAAATGGAGGCAGAGCCAGG - Intergenic
931229068 2:60358750-60358772 GAGAACTATGGGGAAGAGCCAGG - Intergenic
932685252 2:73863692-73863714 TAGAGCAAGGTGGAACAGCCAGG - Exonic
933990357 2:87629305-87629327 TAGAAGAATGAGGAAGACCCAGG - Intergenic
934037460 2:88100060-88100082 GAAAACAAGGAGGAAGAGGGGGG - Intronic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
935105526 2:100039818-100039840 TGGAACAAGGAGGAAGCGACAGG - Intronic
935381420 2:102454689-102454711 CTGCACTAGGAGGAAGAGACAGG - Intergenic
935662030 2:105475133-105475155 CTGAACCAGGAGGAAGAGCAGGG + Intergenic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
936160197 2:110079092-110079114 CTGTACAAAGAGGAAGAGACTGG - Intergenic
936184468 2:110292262-110292284 CTGTACAAAGAGGAAGAGACTGG + Intergenic
936303489 2:111321519-111321541 TAGAAGAATGAGGAAGACCCAGG + Intergenic
936530125 2:113270452-113270474 CAGAAGAAGAAGGCAAAGCCCGG - Intronic
936543729 2:113372771-113372793 CATAACATGGAGGAAGAGTGTGG + Intergenic
938657585 2:133450218-133450240 CAGAACAGGGAAGATTAGCCTGG - Intronic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939531850 2:143373262-143373284 CAGAACCAGGACTAAAAGCCAGG + Intronic
940584732 2:155632636-155632658 TAGCACAAGGAGAAAGAACCTGG + Intergenic
941988059 2:171527679-171527701 CAGAAAAAGGAGGGAGAACTGGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942328220 2:174793711-174793733 CAGAAGAAGGAGGCAGAACATGG - Intergenic
942396700 2:175557397-175557419 CAGCACATGGAAGAAGAGCCTGG + Intergenic
943135114 2:183900279-183900301 CAGACCAAGCAGGAAGAAACTGG - Intergenic
943324903 2:186486292-186486314 CAGGACGAGGAGGAAGACCGGGG - Exonic
944509774 2:200453232-200453254 CAGAACAGCAAGGAAGAGCCGGG + Intronic
944701599 2:202250933-202250955 TATAAAAAGGAGGAAGAGCCAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
945159425 2:206874047-206874069 CAGAGCATGGAGGCAGAGTCAGG - Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
946932498 2:224684449-224684471 AAGAGCAAGGAGGAAGTGCCAGG - Intergenic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
947267116 2:228295090-228295112 CAGAAGAAGGATGTAGACCCTGG + Intergenic
947646642 2:231746845-231746867 CAGAACCAAGAGACAGAGCCAGG + Intronic
947747616 2:232517085-232517107 GAGAAGAAAGAGGGAGAGCCTGG + Intergenic
947931691 2:233970095-233970117 CATAGCCAGGAGGAAGAGACGGG - Intronic
948017695 2:234703274-234703296 GAGAGAAAGGAGGAAGAGCAGGG + Intergenic
948913051 2:241014956-241014978 GAGAAGCAGGAGGGAGAGCCCGG - Intronic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169754194 20:9025895-9025917 CAGAACAAACAAGGAGAGCCTGG - Intergenic
1170353801 20:15470523-15470545 CGGAGTACGGAGGAAGAGCCAGG + Intronic
1170436712 20:16338039-16338061 CAGGAGAAGGAAGGAGAGCCAGG - Intronic
1170448137 20:16451908-16451930 TAGGACAAGAAGGAAGAGTCAGG - Intronic
1171239880 20:23557413-23557435 CCGACCAATGAGGAAAAGCCTGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171367312 20:24634047-24634069 CAGAAGGAGGAGGAAGAGAATGG + Intronic
1172781339 20:37438519-37438541 CAGAGCAGGGAGGAGGAGCGGGG + Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1173029427 20:39341166-39341188 CAACGCAAGAAGGAAGAGCCAGG - Intergenic
1173167748 20:40697875-40697897 CAGAGCAGGGAGGGAGAGACTGG + Intergenic
1173246773 20:41342560-41342582 AAGAACAAGGAGGTAGAGCTGGG + Intronic
1173674035 20:44818317-44818339 CACAAAATGGAGGAAGAGGCAGG + Intergenic
1173846273 20:46190760-46190782 CAGTTCAAGGAGGAAGCACCGGG - Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174711146 20:52706671-52706693 CAGAACAAGGGGGAAAAGCTAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175718012 20:61268338-61268360 CAGAACCAGGAGGCAAAGCCAGG + Intronic
1175823765 20:61925468-61925490 CGGAACACTGAGGAAGGGCCTGG + Intronic
1176190760 20:63808497-63808519 CTGCCCTAGGAGGAAGAGCCTGG - Intronic
1176221994 20:63974179-63974201 CAAAACAAGGAAGACGAGACAGG + Exonic
1177480282 21:21677440-21677462 CAGAACCAGAAGAAAGAGACAGG + Intergenic
1177652874 21:23980664-23980686 CAGAACTAGGAAGAAGTGTCGGG + Intergenic
1177952058 21:27551330-27551352 CAGAAGATGAAGGAAGAGCAAGG + Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179588924 21:42392359-42392381 CAGGAGATGGAGGAAGAGCAGGG + Intronic
1179779105 21:43688085-43688107 CAGAAAAAGAAGGCAGGGCCCGG + Exonic
1179915994 21:44478678-44478700 CAGCACAGGGAGGAAGTGCGTGG + Intergenic
1180135857 21:45861303-45861325 CAGAACAGGCAGGCAGGGCCTGG - Intronic
1181264869 22:21625115-21625137 CAGAGAGAGAAGGAAGAGCCAGG - Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181609731 22:24004424-24004446 TAGAACACAGAGGAAGAGACAGG - Intergenic
1181787458 22:25237481-25237503 TAGGACCAGGAGGAAGAGCAGGG - Intergenic
1182236215 22:28878927-28878949 AAGAAAAAGGAAGAAGGGCCTGG - Intergenic
1182302629 22:29346162-29346184 CACAACAGGGAGGAGGAGCTTGG + Intronic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183746328 22:39694108-39694130 CAGTGCAAGGAGGCACAGCCTGG + Intergenic
1183790668 22:40066132-40066154 CAGAACAGGGAGGGAAACCCAGG - Intronic
1183865272 22:40699397-40699419 GGGAGAAAGGAGGAAGAGCCCGG - Intergenic
1184281939 22:43442366-43442388 CAGGAAAGGGAGGAAGAGCGAGG - Intronic
1184378671 22:44131435-44131457 CAGAAAAAGCTGGAAGGGCCAGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184923405 22:47621393-47621415 GAGAGCCAGGAGGAAGACCCTGG - Intergenic
1184932522 22:47691815-47691837 TAGAACAAGGAGGCAGAGAAAGG + Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1185140096 22:49095347-49095369 CAGAACAGGGAGGCACAGCAGGG + Intergenic
949930563 3:9074970-9074992 CTGAACACAGAGGAAGAGACAGG + Intronic
950134038 3:10568090-10568112 AAGAACAAAGAGGGCGAGCCTGG + Intronic
950459873 3:13114978-13115000 CAGGACAAGCAGGAAGCCCCAGG + Intergenic
952257771 3:31710380-31710402 CAGCACAAGTAGGAAGATGCAGG - Intronic
952847043 3:37696581-37696603 CAGAACAGTGAAGAAGGGCCTGG - Intronic
953191401 3:40691179-40691201 GAGAACAAGGGGGGTGAGCCAGG - Intergenic
953730966 3:45447710-45447732 CAGAAAATGGAGGAAGACACAGG + Intronic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954200461 3:49020781-49020803 CAGTCCCAGGAGGAAGACCCGGG + Intronic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
954774697 3:53006279-53006301 CGGAATGGGGAGGAAGAGCCTGG + Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955328486 3:58027587-58027609 TAGACCTAGGAGTAAGAGCCAGG - Intronic
955418666 3:58715951-58715973 CAGCACAAGGGAGAAGTGCCAGG - Intergenic
955480891 3:59388670-59388692 CAGAATAAAGAGGAAGTGACAGG - Intergenic
955523762 3:59800497-59800519 CTGAACCAGGAGTAAAAGCCCGG - Intronic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
959376452 3:105593900-105593922 CAGAACAATGAGGCAGAGAAAGG - Intergenic
960092904 3:113659878-113659900 CAGAACCAGGAGGTGGAGCAGGG + Exonic
961306142 3:125959902-125959924 CAGGACAAGGAGTGAGAGCCGGG - Intergenic
962409380 3:135128086-135128108 AAGAAAAATGAGGAAGAGCATGG + Intronic
963161175 3:142151744-142151766 CAGAATAAGGAGGAACAGCTTGG + Intergenic
964468367 3:157023700-157023722 CAGAGCCAGGATTAAGAGCCAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965566389 3:170123185-170123207 CATAATAATAAGGAAGAGCCTGG - Intronic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966118620 3:176496361-176496383 CCGAACTAGGAGGAAGAGGTAGG - Intergenic
966420803 3:179732461-179732483 CAGAACCAGAAGGGAAAGCCAGG - Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
968007798 3:195254917-195254939 CAGAAAGATGAGGTAGAGCCAGG + Intronic
968286168 3:197510109-197510131 CAGGAGAAGGCAGAAGAGCCCGG - Exonic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968779349 4:2568025-2568047 CAGAACCAGGAGGAAGGGGTGGG - Intronic
969090979 4:4693837-4693859 CAGAGCAAGTCGGAAGTGCCAGG - Intergenic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970194400 4:13541267-13541289 CTGCACAAGCAGGAAGCGCCTGG - Exonic
970651975 4:18188856-18188878 AAGAAGGAGGAGGAAGTGCCAGG - Intergenic
971026844 4:22597510-22597532 CAGAACAAGGTGTCAGAGTCAGG - Intergenic
972706787 4:41552541-41552563 GAGAACAAGAAGCAAGAGACAGG - Intronic
973614071 4:52661783-52661805 CAGAGCTAGAAGGCAGAGCCTGG + Intergenic
973766521 4:54168178-54168200 CAGAAAGATGAGGAAGAGCCAGG + Intronic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
975344862 4:73282110-73282132 CAGAGCAAGATGGAAAAGCCTGG + Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975533295 4:75422551-75422573 CAGAACAAGAAGGCAGAGAAAGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977239038 4:94544122-94544144 CTGACCAAGGAGGCAGAGACTGG - Intronic
977984092 4:103361220-103361242 CTGAAACAGGAGGAAGAGCACGG - Intergenic
979078751 4:116307671-116307693 CAGGAAAAGGAGGCAGAGCCTGG + Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
980474323 4:133291991-133292013 TAGAACAGGGAGATAGAGCCTGG + Intergenic
981184885 4:141789279-141789301 CAGACCAAGGTAGAAGGGCCTGG - Intergenic
981194104 4:141898523-141898545 GAGAGAAAGGAGGAAGTGCCAGG - Intergenic
982833258 4:160089826-160089848 CAGAAGATGAAGGAAGAGCAAGG - Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983657700 4:170099764-170099786 GTGAACAGGGAGGAAGAACCTGG - Intergenic
983954825 4:173685251-173685273 CAGAATAAAGATGAACAGCCCGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984912621 4:184688561-184688583 CAGAAAGAGCAGGAAGGGCCAGG - Intronic
985165791 4:187092724-187092746 TAGAACAGGGAGGAAAAGACAGG - Intergenic
985521606 5:376350-376372 CAGGACATGGAGGCAGAGCCTGG - Intronic
985868260 5:2533226-2533248 GAGGAGGAGGAGGAAGAGCCTGG + Intergenic
986038513 5:3963510-3963532 CAGAACCTGGAGGAAGAACATGG - Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986285259 5:6354331-6354353 CAGAAGAAGGAAGCAGAGGCTGG + Intergenic
986285317 5:6354572-6354594 CGGAAGAAGGAGGCAGAGGCTGG + Intergenic
986480221 5:8179430-8179452 AAGAACATGGGGGAAGAGCATGG - Intergenic
987073407 5:14358788-14358810 CAGGATATGGAGGCAGAGCCAGG + Intronic
987261692 5:16210854-16210876 CAGGACCAGGTGGAAGAGCAGGG + Intergenic
988974105 5:36498227-36498249 CAGACCAACAAGAAAGAGCCTGG + Intergenic
989162275 5:38402960-38402982 CAGGGCAAGGAAGAACAGCCTGG + Intronic
989790067 5:45388181-45388203 AAGAACAAAGATGAAGAGCTAGG - Intronic
990262427 5:54038943-54038965 CAAAGCATGGAGGAAGAGCTTGG - Intronic
990989203 5:61668864-61668886 CAGAATCTGGAGGAAGAGCCAGG + Intronic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992497492 5:77308255-77308277 CAGACCAAGAAGGAAAAGGCAGG + Intronic
993435680 5:87890340-87890362 CAGAACATAGAAGATGAGCCTGG + Intergenic
995870014 5:116734663-116734685 CAGCCCAAGGAGGCAGAGGCAGG + Intergenic
996339856 5:122424653-122424675 GAGAATTAGGGGGAAGAGCCAGG - Intronic
996498516 5:124189508-124189530 GAGAACAAGCAGGAAGAATCAGG + Intergenic
997383007 5:133450850-133450872 CAGACCAATGGGGGAGAGCCAGG + Intronic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
998285032 5:140850814-140850836 CAGCACAAGGAGAAAGGCCCGGG - Exonic
998769856 5:145530580-145530602 AAGAATAAGGAGGGAGAGACAGG + Intronic
999512910 5:152271411-152271433 CAAAACGAGCAGGAAGAGTCCGG + Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000598868 5:163248297-163248319 CAGAAGAAGGTGGAAGAAGCTGG + Intergenic
1000699191 5:164427218-164427240 TTCAACAAGGAAGAAGAGCCCGG + Intergenic
1000853855 5:166374920-166374942 CAAAACAAGGAAGATGAGCAAGG + Intergenic
1001827455 5:174756924-174756946 CAGAATAAGGTGGAAGGACCAGG + Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1002956423 6:1869821-1869843 CACATCCAGGAGGAAGAGCCAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003451450 6:6237364-6237386 AAAATCAAGGATGAAGAGCCAGG - Intronic
1004346895 6:14857239-14857261 CACAGCAAGGAGCAAGAGCGAGG - Intergenic
1004891552 6:20105694-20105716 CTGAACCAGGAGGCAGAGGCTGG + Intronic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005083700 6:21981927-21981949 CAGCACAAGAAGGAAGACACAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1005817367 6:29565471-29565493 GAGAAGTAGGAGGCAGAGCCTGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006581696 6:35081185-35081207 CAGAGGAATGAGGTAGAGCCTGG - Intronic
1006599213 6:35214438-35214460 CAGGACAAGCAGGCAGAGCCCGG - Exonic
1007659808 6:43477197-43477219 CTGATGAAGGTGGAAGAGCCTGG + Intergenic
1007787586 6:44289995-44290017 CATCTCAAGGAGGAAAAGCCTGG + Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1007924988 6:45643229-45643251 CAGCACAAGGAAGAAGACTCTGG - Intronic
1010074288 6:71782979-71783001 CAAGAGAAGGAGGAAGAGCGAGG + Intergenic
1011179077 6:84598851-84598873 CATAACAAGGAGCAGGAGCTGGG - Intergenic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016887503 6:148971644-148971666 CACAGCACGGAGGAAGAACCAGG + Intronic
1016936137 6:149450722-149450744 CTGTACCAGGAGGATGAGCCTGG + Exonic
1017547814 6:155470253-155470275 CAGAGCATGGAGGCAGAGACTGG - Intergenic
1017589190 6:155960140-155960162 CAGAAGCAGCAGGAAGAGACAGG - Intergenic
1018171382 6:161146013-161146035 CAGAACAAGTAGGGGGACCCTGG + Intronic
1018220343 6:161571858-161571880 CAGAACAAGAAGGCAGAGAACGG + Intronic
1018420402 6:163635954-163635976 CAGAAGAGGGTGGAAGCGCCAGG + Intergenic
1018505751 6:164466082-164466104 GAGGAGTAGGAGGAAGAGCCAGG - Intergenic
1018903146 6:168061110-168061132 CTGATGCAGGAGGAAGAGCCCGG + Intronic
1019178200 6:170171485-170171507 CAGAACAGGGAGGAACAACCCGG - Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1021257093 7:18405910-18405932 CAGAACAGAGAGGAACTGCCAGG - Intronic
1021389773 7:20077491-20077513 CAAACCAAGGTGGTAGAGCCAGG + Intergenic
1021645787 7:22788285-22788307 CAGAACAAGCAAAAAGAGCCAGG + Intergenic
1022224938 7:28353463-28353485 AAGAACAAGGAAGACTAGCCGGG + Intronic
1022754882 7:33276922-33276944 CACAAGAGGGTGGAAGAGCCAGG + Intronic
1022785829 7:33635625-33635647 CACCTCAAGGAGGAAGACCCTGG - Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024454194 7:49584373-49584395 GAGAACATGGAGGCAGAGACTGG + Intergenic
1025912882 7:65841684-65841706 CACAGCAGGGAGGAAGAGCTCGG - Intergenic
1026180305 7:68033672-68033694 GATGACAAGGAGGAAGTGCCTGG + Intergenic
1026205600 7:68254936-68254958 AAGAAAAAGGAGGAAGAGAAAGG - Intergenic
1026205746 7:68255695-68255717 GAGAAGAAGGAGGAAGAGGTGGG - Intergenic
1026627432 7:72008483-72008505 CAGAACAAGAAGCAAGAGAAGGG + Intronic
1026907935 7:74073683-74073705 CACAAAACGGAGGTAGAGCCAGG - Intergenic
1027232111 7:76278786-76278808 CTGAACATGGAGGTAGACCCAGG - Intronic
1027616185 7:80427472-80427494 CGTAACAAGGAGTAAGAGACCGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028134673 7:87212918-87212940 CAGCACAAGGAGTAAGTGCCAGG + Intronic
1028304214 7:89241963-89241985 CAGGATAAGTAGGAAAAGCCTGG - Intronic
1028826648 7:95281357-95281379 GACAGGAAGGAGGAAGAGCCAGG - Intronic
1028981589 7:96973148-96973170 AAGAACAGTGAGGAGGAGCCAGG + Intergenic
1030600290 7:111584378-111584400 CAGAACAAAGCGGTAGAGGCAGG - Intergenic
1030916599 7:115321992-115322014 TAGAAAAAAGAGGAAGAACCAGG + Intergenic
1031922700 7:127613401-127613423 AACCACAAGGAGGAAGAGTCTGG - Intronic
1032502965 7:132413733-132413755 CATCACAAGTAGGAAGACCCTGG - Intronic
1032980462 7:137276302-137276324 TAGAGAAAGGAGGAAGAGCTGGG - Intronic
1033142150 7:138837287-138837309 CAGAAGAAGGAGGAAGAATGCGG + Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034634136 7:152553926-152553948 CTGCACAAGGAGGAAGAGCGTGG - Intergenic
1034857646 7:154567472-154567494 AAGAAGAAGAAGGAAGATCCTGG - Intronic
1034996438 7:155580199-155580221 CAGCACAGAGAGGAAGAGACTGG + Intergenic
1035376661 7:158411116-158411138 CAGAAACAGGTGGAAGAGCGAGG - Intronic
1035945883 8:3962105-3962127 CAGAAAGAGGAGGAAGGTCCTGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036097734 8:5741988-5742010 CAGAACAAGGAGGTGTCGCCTGG - Intergenic
1036131905 8:6123282-6123304 CAGAAGAAGGTGGAAGAAGCAGG - Intergenic
1036463505 8:8974759-8974781 GAGAACAAGGGGGAAGAGAAGGG - Intergenic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1037862238 8:22413685-22413707 CAGAAAATGGAGGAACAACCCGG + Intronic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038226782 8:25665098-25665120 CAGAGCAAGGATGAAAACCCAGG - Intergenic
1038662168 8:29506716-29506738 CAGAACAAAGATGAAGAGGAGGG - Intergenic
1039466153 8:37786800-37786822 CCGAGCAAGGTGGAGGAGCCGGG + Intronic
1039893092 8:41697562-41697584 CAGAACCAGGAGGGAGAGCGGGG - Intronic
1040596034 8:48838671-48838693 CAATGCAAGGAGGAAGTGCCTGG - Intergenic
1040894289 8:52349851-52349873 CAGAGCAAGGAGGGAGAGTAGGG + Intronic
1041060912 8:54033518-54033540 CAGGGCAGGGAGGAAGTGCCAGG + Intergenic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041642178 8:60214989-60215011 CAGAAAAAGGAGGAAGAAAAGGG + Intronic
1042061660 8:64824560-64824582 CAGAGCAAGTAGGCAGAGACTGG - Intergenic
1043057721 8:75461292-75461314 CAAAAAATGGAGGAAGACCCTGG - Intronic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1045345496 8:101290024-101290046 CAGGAGAAGGAGGAAGTCCCAGG - Intergenic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046444981 8:114306670-114306692 CAGGATGAGGAGGAAGAGCTGGG - Intergenic
1047080252 8:121452539-121452561 CAGGACAAGGAGCATAAGCCAGG + Intergenic
1047357904 8:124140760-124140782 CACAGGAAGGAGGAAGGGCCAGG + Intergenic
1047455617 8:125007455-125007477 CAGTACAAGGATAAAGAGACTGG + Exonic
1047943948 8:129855537-129855559 GAGTACTAGGAGGAAGAGCCGGG - Intronic
1048384779 8:133901924-133901946 CATAACACGCAGGAAGAGGCTGG + Intergenic
1048838713 8:138546282-138546304 AAGAACGAGGAGGAAGTGCCAGG + Intergenic
1049037402 8:140087222-140087244 GAGACAGAGGAGGAAGAGCCAGG - Intronic
1049337895 8:142096220-142096242 CAGAGCAGTGAGGAGGAGCCAGG - Intergenic
1049340456 8:142109566-142109588 CAGAACCAGGGCAAAGAGCCTGG + Intergenic
1049445898 8:142631336-142631358 CAGAACAAGGGTGGAGGGCCTGG + Intergenic
1049497707 8:142944262-142944284 GAGAACAATGAGGAAGAGTCTGG - Intergenic
1049738311 8:144221805-144221827 TAGCACAAGGAGGAAGTGCTTGG + Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1051095937 9:13465258-13465280 GAGAAGAAGGAGGAAGAGAAAGG - Intergenic
1052843782 9:33316504-33316526 AGAAACAAGGAGGAAGAGACTGG - Intronic
1053447043 9:38160776-38160798 GATCACAAGGTGGAAGAGCCAGG - Intergenic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1057709687 9:97428151-97428173 CCTAACAAGGAGGAAGAGGGTGG - Intronic
1057798828 9:98176856-98176878 CAGAACCAGGAACAAGATCCAGG + Intronic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059337820 9:113580225-113580247 TAGAAGGAGGAGGAACAGCCTGG - Intronic
1059366995 9:113794161-113794183 CAGAACACAGAGGCAGACCCAGG + Intergenic
1059433006 9:114260975-114260997 AAGATCCAAGAGGAAGAGCCTGG - Intronic
1059820659 9:117968747-117968769 CAGAAGAAGGAAGAACATCCAGG + Intergenic
1060626748 9:125120395-125120417 GAAAAACAGGAGGAAGAGCCAGG + Intronic
1060722723 9:125989429-125989451 CAGCAGAAGGTGGCAGAGCCAGG - Intergenic
1061108987 9:128553172-128553194 CCGTAGAGGGAGGAAGAGCCCGG + Intronic
1062453453 9:136625078-136625100 CAGAACCTGGGGGAAGCGCCCGG + Intergenic
1062453457 9:136625097-136625119 CAGACCAAGGTGGGAGAGGCCGG - Intergenic
1203655625 Un_KI270752v1:21497-21519 CAGCACTAGGAGGCAGAGGCAGG - Intergenic
1185448605 X:271389-271411 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448617 X:271438-271460 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448629 X:271487-271509 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448641 X:271536-271558 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448652 X:271585-271607 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448664 X:271634-271656 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448676 X:271683-271705 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448687 X:271732-271754 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448700 X:271781-271803 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185448712 X:271830-271852 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448725 X:271879-271901 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185448737 X:271928-271950 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448748 X:271977-271999 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448759 X:272026-272048 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448771 X:272075-272097 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448781 X:272124-272146 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185448793 X:272173-272195 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448805 X:272222-272244 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185448818 X:272271-272293 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185448831 X:272320-272342 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448844 X:272369-272391 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448856 X:272418-272440 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448867 X:272467-272489 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448879 X:272516-272538 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448890 X:272565-272587 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185448900 X:272614-272636 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185448911 X:272663-272685 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448923 X:272712-272734 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448934 X:272761-272783 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185448945 X:272810-272832 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448957 X:272859-272881 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185448980 X:272955-272977 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185448992 X:273004-273026 CAGGACACGGAGGAAGGGCCAGG + Intergenic
1185449002 X:273053-273075 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185449014 X:273102-273124 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449025 X:273151-273173 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449038 X:273200-273222 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449051 X:273249-273271 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449064 X:273298-273320 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449076 X:273347-273369 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449087 X:273396-273418 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449100 X:273445-273467 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449113 X:273494-273516 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449126 X:273543-273565 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449139 X:273592-273614 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449151 X:273641-273663 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449163 X:273690-273712 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449191 X:273793-273815 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449203 X:273842-273864 CAGGACACGGAGGAAGGGCCAGG + Intergenic
1185449214 X:273891-273913 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449226 X:273940-273962 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449238 X:273989-274011 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449249 X:274038-274060 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449262 X:274087-274109 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449275 X:274136-274158 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449288 X:274185-274207 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449301 X:274234-274256 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449313 X:274283-274305 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185449324 X:274332-274354 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449337 X:274381-274403 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185449349 X:274430-274452 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449361 X:274479-274501 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185449373 X:274528-274550 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449384 X:274577-274599 CAGGACACAGAGGAAGGGCCAGG + Intergenic
1185449395 X:274626-274648 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449408 X:274675-274697 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449420 X:274724-274746 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449432 X:274773-274795 CAGGACACGGAGGAAGGGCCGGG + Intergenic
1185449444 X:274822-274844 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185449456 X:274871-274893 CAGGACACAGAGGAAGGGCCGGG + Intergenic
1185748317 X:2589785-2589807 CAGATCCAGGAGACAGAGCCAGG - Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186730227 X:12402117-12402139 GAGGAGAAGGAGGAAGAGACTGG + Intronic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1187217682 X:17292769-17292791 CAGAATAAGAAAGAAAAGCCAGG - Intergenic
1187363126 X:18646079-18646101 CAGAACAACAAGGTAGAGTCTGG + Exonic
1187617248 X:21010269-21010291 CAGAATAATGCTGAAGAGCCTGG + Intergenic
1189868224 X:45353625-45353647 CTGACCAAGGAGGCAGAGACTGG + Intergenic
1190172842 X:48125359-48125381 AAGAACCAGGAGTGAGAGCCAGG - Intergenic
1190219177 X:48500037-48500059 CTTCACAAGGAGTAAGAGCCAGG + Intergenic
1190275083 X:48894051-48894073 CAGAACAGGGTGGAAGGGGCTGG + Intronic
1190385782 X:49881007-49881029 CAGAAGGAGGTGCAAGAGCCAGG - Exonic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190732025 X:53232850-53232872 CAGAAGTAGGAGGCAGAGGCAGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192317802 X:70066113-70066135 CAGGGCAAGGAGGAAGATCTTGG + Intergenic
1192602890 X:72483406-72483428 GAGAAAAAGGAGGAAGTTCCAGG - Intronic
1192681395 X:73257385-73257407 GAGAAAAAGGAGGAAAAGCGGGG + Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1195756093 X:108200002-108200024 CAGTACAAGGAAGATAAGCCTGG + Intronic
1196459356 X:115913821-115913843 CACAAAAAGGAGGAAGAGAAAGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198281764 X:135149629-135149651 CAGATGAAGGAGGAAGTGCTTGG - Intergenic
1198289195 X:135222893-135222915 CAGATGAAGGAGGAAGTGCTTGG + Intergenic
1199740690 X:150733605-150733627 CAGAACCTGGAGGAAAACCCAGG - Intronic
1200181804 X:154155337-154155359 CAGAGCAAGGGAGGAGAGCCAGG + Intronic
1200187453 X:154192451-154192473 CAGAGCAAGGGAGGAGAGCCAGG + Intergenic
1200193102 X:154229591-154229613 CAGAGCAAGGGAGGAGAGCCAGG + Intronic
1200198857 X:154267395-154267417 CAGAGCAAGGGAGGAGAGCCAGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic