ID: 915736237

View in Genome Browser
Species Human (GRCh38)
Location 1:158087382-158087404
Sequence CAATTTATTACACACCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915736237_915736248 7 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736248 1:158087412-158087434 CCAGGGAACCATGGGGGTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 252
915736237_915736251 18 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736251 1:158087423-158087445 TGGGGGTGTGGGCAGCAACTGGG 0: 1
1: 0
2: 2
3: 30
4: 331
915736237_915736246 6 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736246 1:158087411-158087433 CCCAGGGAACCATGGGGGTGTGG 0: 1
1: 1
2: 4
3: 35
4: 353
915736237_915736239 -10 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736239 1:158087395-158087417 TAATAAATTGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 163
915736237_915736243 1 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736243 1:158087406-158087428 CTCTCCCCAGGGAACCATGGGGG 0: 1
1: 0
2: 2
3: 15
4: 211
915736237_915736250 17 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736250 1:158087422-158087444 ATGGGGGTGTGGGCAGCAACTGG 0: 1
1: 0
2: 2
3: 31
4: 322
915736237_915736240 -2 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736240 1:158087403-158087425 TGTCTCTCCCCAGGGAACCATGG 0: 1
1: 0
2: 3
3: 23
4: 200
915736237_915736241 -1 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736241 1:158087404-158087426 GTCTCTCCCCAGGGAACCATGGG 0: 1
1: 0
2: 0
3: 12
4: 144
915736237_915736242 0 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736242 1:158087405-158087427 TCTCTCCCCAGGGAACCATGGGG 0: 1
1: 0
2: 1
3: 26
4: 218
915736237_915736252 19 Left 915736237 1:158087382-158087404 CCTGGTAGGTGTGTAATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 915736252 1:158087424-158087446 GGGGGTGTGGGCAGCAACTGGGG 0: 1
1: 0
2: 4
3: 55
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915736237 Original CRISPR CAATTTATTACACACCTACC AGG (reversed) Intronic
902439891 1:16422276-16422298 CCAGTTATTACACACTTACTAGG + Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
904797123 1:33064932-33064954 CAATCTATTACACAGCTTTCAGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908985845 1:70020147-70020169 TCATTTATTACACTCCTGCCTGG - Intronic
909113832 1:71509696-71509718 AAATTTATTAGGCACCCACCTGG - Intronic
909413319 1:75378518-75378540 CAATCTATTAAACAGCTTCCAGG - Intronic
909566845 1:77062162-77062184 TTATTTATTAAGCACCTACCAGG + Intronic
910578792 1:88798082-88798104 CAATTTATTTTTAACCTACCAGG - Intronic
912344264 1:108950140-108950162 AAAATTATTTCAAACCTACCTGG - Intronic
912365713 1:109132132-109132154 AAATTTATTGCAGACCAACCAGG + Intronic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916009528 1:160692209-160692231 CAATCTATTATACAGCTTCCAGG - Intronic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
916955632 1:169831457-169831479 CAGGTTATTACACACCTCACTGG - Intronic
921611485 1:217217201-217217223 TCATTTATTACACACCTATTGGG + Intergenic
923824569 1:237485703-237485725 ATATTTATTAAGCACCTACCAGG - Intronic
1063531120 10:6832197-6832219 CAATCTATTACACAGCTTCCAGG + Intergenic
1065201068 10:23313666-23313688 CAAGTTATTAACCACCTCCCTGG - Intronic
1067332067 10:45331652-45331674 CAAGTTCTTAAACACCTACAAGG - Intergenic
1073067082 10:100767942-100767964 GAATTTATTGCACAGCTACTTGG + Intronic
1073086654 10:100895307-100895329 GCATTTATTTCACACCTACTTGG - Intergenic
1075352817 10:121739964-121739986 CATTTTATCACCAACCTACCAGG + Intergenic
1075816997 10:125272022-125272044 GAGTTCATTATACACCTACCTGG + Intergenic
1076993092 11:285630-285652 CAATTAACTAAGCACCTACCTGG + Intergenic
1077586216 11:3455482-3455504 CAATCTATTACACAGCTTTCAGG + Intergenic
1077703138 11:4459990-4460012 CAATCTATTACACAGCTCTCAGG + Intergenic
1078516685 11:12028533-12028555 CTATTTATTCCACATCTACTGGG - Intergenic
1081301229 11:41454472-41454494 ATATTTATTAAGCACCTACCAGG - Intronic
1083394593 11:62381451-62381473 CAATCTATTACACAGCTTTCAGG + Intronic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1086379792 11:86240495-86240517 CACTTTATTACACACGTCCATGG + Intergenic
1087723859 11:101696495-101696517 CAATCTATTAAACAGCTTCCAGG - Intronic
1088545853 11:110957958-110957980 GAATTTATTGGACACCTATCTGG - Intergenic
1089471979 11:118728721-118728743 CAATCTATTAAACAGCTTCCAGG + Intergenic
1090094644 11:123730590-123730612 CAATTTCTTACCGTCCTACCTGG - Exonic
1092552531 12:9519140-9519162 GAATTTATTACACACCTGCATGG + Intergenic
1094519588 12:31171472-31171494 GAATTTATTACACACCTGCATGG - Intergenic
1094874722 12:34627825-34627847 CAATCTATTACACAGCTTTCAGG + Intergenic
1095180433 12:39141965-39141987 CAATCAATTACTCACCTAACAGG - Intergenic
1095920377 12:47524204-47524226 CAAGTTATTAGAGACCTACAAGG - Intergenic
1097331322 12:58335461-58335483 CAATCTATTATACAGCTTCCAGG + Intergenic
1097360879 12:58656531-58656553 CAAGTGTTTACACACCCACCAGG + Intronic
1097965245 12:65572420-65572442 CAATTTGTCCCACACCGACCTGG + Intergenic
1099291594 12:80782971-80782993 CAAACTAAAACACACCTACCTGG + Intergenic
1102135588 12:110571469-110571491 CAATCTATTAAACAGCTTCCAGG - Intronic
1102426934 12:112851127-112851149 CAATTTATTAAGCACTTACTAGG + Intronic
1105022233 12:132824726-132824748 CCATTTATCACCCACCCACCCGG - Intronic
1105055479 12:133094996-133095018 CAATCTATTACACAGCTTTCAGG + Intronic
1107625139 13:42274184-42274206 CATTTTATTAATCAACTACCTGG + Intronic
1108563007 13:51665308-51665330 CAACTTAAAACACACCTATCTGG + Intronic
1109908677 13:68880086-68880108 CAATATAGAACAGACCTACCAGG + Intergenic
1110402102 13:75104135-75104157 TAATATATTACAAACCTCCCTGG - Intergenic
1111772540 13:92616394-92616416 CACTTTATTACATACCTCCAAGG - Intronic
1113635883 13:111918894-111918916 CAAGTTTTTACTCACCTGCCTGG + Intergenic
1114199886 14:20510254-20510276 CATTTTATTACACAGCAACAGGG + Intronic
1114894108 14:26964196-26964218 CAATTTATTCTAAACCTCCCTGG - Intergenic
1115173539 14:30535519-30535541 CATTGTATTGCACACCTAACAGG + Intergenic
1116862234 14:50003743-50003765 CAATTTATTGCAGACGTTCCTGG - Intronic
1121598128 14:95181460-95181482 ATATTTATTACACACCTACTTGG - Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1123722691 15:23073743-23073765 CAACTGAATACACACCTCCCAGG + Intergenic
1125396229 15:39251145-39251167 CCATTTATTAGGCACCTACCAGG - Intronic
1126014919 15:44341462-44341484 TAATTTATTACCCAGCCACCAGG + Intronic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1128172674 15:65526759-65526781 TTTTTTATTACCCACCTACCAGG + Intergenic
1128396655 15:67233030-67233052 CCACTTATTACACACATTCCTGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1135104176 16:19632982-19633004 GAATATATCACACACCTTCCAGG - Intronic
1135952439 16:26927750-26927772 CAATTGTTAACACACCTTCCAGG + Intergenic
1139014406 16:62672582-62672604 CAATTTTTAACAAACCTCCCTGG - Intergenic
1141237411 16:82231327-82231349 GAAGTTATTACATTCCTACCTGG + Intergenic
1144069452 17:11654898-11654920 CAATATATTACACAACCTCCAGG + Intronic
1144069522 17:11655556-11655578 CAATATATTACACAACCTCCAGG - Intronic
1147401714 17:40184286-40184308 CCATTTCTTGGACACCTACCAGG + Exonic
1147637136 17:41970980-41971002 CAGTTTAATACACACCTTGCAGG - Intronic
1148346431 17:46906385-46906407 AAATTTATTCCCCACCTTCCTGG - Intergenic
1149301496 17:55308350-55308372 CCATTTATTGCACACTTTCCGGG + Intronic
1157633245 18:49122158-49122180 CCATATATAACACATCTACCAGG - Intronic
1159626326 18:70699385-70699407 AAATTTATCCCAGACCTACCTGG + Intergenic
1160334223 18:78023152-78023174 CAATTTACTAAACAACTACTTGG + Intergenic
1163919830 19:20278020-20278042 CAATCTATTACACAGCTTTCAGG - Intergenic
1164153815 19:22576362-22576384 CAATCTATTACACAGCTTCCAGG - Intergenic
1164371217 19:27645967-27645989 CAATCTATTATACAGCTTCCAGG + Intergenic
1164960122 19:32420744-32420766 CAATTTATTAAACACATGGCAGG - Intronic
1165607056 19:37114724-37114746 CAATCTATTACACATTTTCCAGG + Intronic
1167275042 19:48532597-48532619 GATTTAATTTCACACCTACCGGG + Intergenic
1202671124 1_KI270709v1_random:53137-53159 CAATTAATAACACACCTGCGAGG + Intergenic
925325716 2:3020398-3020420 CCATTTAGAACCCACCTACCTGG - Intergenic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
926586703 2:14694058-14694080 ATATTTACTAAACACCTACCAGG - Intergenic
927437382 2:23078991-23079013 CAATTCTTGACACACATACCTGG + Intergenic
927607635 2:24502040-24502062 CTGTTTATTGCACAACTACCTGG + Intronic
927812879 2:26189889-26189911 CAACATAATTCACACCTACCTGG + Intergenic
933705798 2:85289295-85289317 GAATTTATTAGGCATCTACCTGG - Intronic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
948228231 2:236329688-236329710 AAATTTATTAAACATCTACTTGG + Intronic
1171485662 20:25483790-25483812 CACTTTCTTAGACACCTCCCAGG + Intronic
1172337432 20:34128984-34129006 CAATCTATTACACAGCTTTCAGG - Intergenic
1172345290 20:34193373-34193395 AAATTTATTACATACCTCTCTGG - Intergenic
1177259402 21:18710637-18710659 CATGTAATTACACACCTACATGG + Intergenic
1178092348 21:29178101-29178123 AAATTTATTATACACTTAGCTGG + Intergenic
1178812385 21:35895951-35895973 CCACTTATTAAACATCTACCCGG - Intronic
1180100660 21:45582599-45582621 CAATCTATGACAAACCTTCCAGG - Intergenic
1180837866 22:18940106-18940128 CAATCTATTAAACAGCTTCCAGG - Intergenic
1183864913 22:40696468-40696490 CAATCTATTACACAGCTTTCAGG + Intergenic
951599539 3:24358079-24358101 ATATTTATTAAACATCTACCAGG - Intronic
951635232 3:24767001-24767023 CAATTTATGTCCCACCTCCCTGG - Intergenic
951771138 3:26258883-26258905 TAATATCTTACATACCTACCTGG + Intergenic
952341552 3:32451581-32451603 CACTTTACTACATCCCTACCAGG - Intronic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
955115234 3:55991767-55991789 CAATTTCTTACACACTTCGCTGG + Intronic
957069118 3:75551835-75551857 CAATCTATTACACAGCTTTCAGG - Intergenic
957499391 3:81034367-81034389 CAAATTATTGAACACCTAACTGG + Intergenic
959070001 3:101693326-101693348 CAATCTATTACACAGCTTCCAGG - Intergenic
961296854 3:125891726-125891748 CAATCTATTAAACAGCTTCCAGG - Intergenic
963696075 3:148567123-148567145 CAATCTATTAAACAGCTTCCAGG + Intergenic
969001407 4:3985436-3985458 CAATCTATTACACAGCTTTCAGG + Intergenic
969812514 4:9659426-9659448 CAATCTATTACACAGCTTTCAGG - Intergenic
970109726 4:12624308-12624330 CTATTTATTAAACACCTTACAGG + Intergenic
970343269 4:15128778-15128800 AAATTTATTTCTCACCTTCCTGG - Intergenic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
972924709 4:43989494-43989516 GAATTTATTAAGCACCTACTAGG - Intergenic
975060063 4:69986018-69986040 CACTGTAATACACACCCACCTGG - Intergenic
975387575 4:73775265-73775287 CAATTTATTTTACATCTATCCGG - Intergenic
975477596 4:74841528-74841550 CAGGCTATTACTCACCTACCTGG + Intergenic
976888617 4:90016338-90016360 TAATTTATTACATATCTACTAGG - Intergenic
978479774 4:109176047-109176069 ACATTTATCAGACACCTACCAGG + Intronic
980131799 4:128823222-128823244 CAATCTATTAAACCCCTTCCAGG - Intronic
981434884 4:144708777-144708799 CAATTCATTTAAAACCTACCAGG - Intronic
982397626 4:154929341-154929363 AAATTTGTTTCCCACCTACCTGG - Intergenic
982435635 4:155381537-155381559 CAATTTACAAAACACCTTCCGGG + Intergenic
982876712 4:160660050-160660072 CAATCTATTATACAGCTTCCAGG - Intergenic
983027759 4:162758317-162758339 CAATTTTTTTCCCACCTATCTGG - Intergenic
983215313 4:164997103-164997125 CAATCTATTACACCACTTCCAGG - Intergenic
983816592 4:172136400-172136422 CAATTTTTTAAAAACATACCTGG + Intronic
986372621 5:7094983-7095005 CCATTCATTACACACCTAATAGG + Intergenic
987326410 5:16815559-16815581 ACATTTATTGCACAACTACCAGG + Intronic
988380779 5:30494661-30494683 CAATCTATTAAACAGCTTCCAGG + Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999752904 5:154643173-154643195 CAATCTATTACACAGCTCTCAGG + Intergenic
999952476 5:156665431-156665453 CAATCTATTAAACAGCTTCCAGG + Intronic
1007253653 6:40513542-40513564 CAATTTTTTGAACACCTACTAGG + Intronic
1007572355 6:42902163-42902185 CAATCTATTACACAGCTTTCAGG + Intergenic
1007772332 6:44201713-44201735 ATATTTATGAGACACCTACCTGG + Intergenic
1008450046 6:51640608-51640630 GAATTGATTACACAACTACCAGG + Intronic
1008518910 6:52344508-52344530 ATATTTATTACACACCTGGCTGG - Intergenic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1012517551 6:100080226-100080248 CAATGTATTACAGACCCATCTGG + Intergenic
1014495313 6:122114709-122114731 GACTTTTCTACACACCTACCAGG - Intergenic
1017021823 6:150146082-150146104 GAATTTATTACCTACCTACTAGG + Intronic
1017419270 6:154257049-154257071 CAATTTATTACAGATTTATCAGG + Intronic
1018986869 6:168644329-168644351 CAGTTTAAAACACACCGACCTGG - Intronic
1019976936 7:4590443-4590465 CAATCTATTATACAGCTTCCAGG + Intergenic
1019977871 7:4598946-4598968 CAATCTATTATACAGCTTCCAGG + Intergenic
1025616805 7:63126324-63126346 CAATATTTTACTCACCTAACTGG + Intergenic
1027767620 7:82364988-82365010 CAATTTATAACACAGCCACCTGG + Intronic
1027796820 7:82705428-82705450 AAATGAATTACACACCTACATGG - Intergenic
1029967221 7:104752336-104752358 CAATCTATTAAACAGCTTCCAGG + Intronic
1030512510 7:110501271-110501293 CAATTTATTTCTCACCATCCTGG + Intergenic
1031739263 7:125408417-125408439 TAATATATTACTCACCTACTAGG - Intergenic
1032648302 7:133850387-133850409 CAATTTTTTCCAAACCTACTTGG - Intronic
1032760128 7:134932832-134932854 CATTTTAGTACACGCCTGCCTGG - Intronic
1032792250 7:135251146-135251168 CACTTTATAACAGACATACCTGG - Intronic
1033077444 7:138262801-138262823 CAGTTCATTACACACCCAGCAGG + Intergenic
1034823226 7:154236384-154236406 CAATTTATTACGAACCTAAATGG + Intronic
1036292480 8:7505891-7505913 CAATCTATTAAACAGCTTCCAGG + Intronic
1036375826 8:8198656-8198678 CAATCTATTACACAGCTTTCAGG - Intergenic
1036853703 8:12224487-12224509 CAATCTATTACACAGCTTTCAGG + Intergenic
1036875079 8:12466997-12467019 CAATCTATTACACAGCTTTCAGG + Intergenic
1038155617 8:24986826-24986848 CTATTTATTAAGCACCTCCCAGG + Intergenic
1040317215 8:46270557-46270579 CAATCTATTACACAGCTTTCAGG + Intergenic
1040439519 8:47426667-47426689 AAATTTATTTCTCACCTGCCTGG + Intronic
1042168096 8:65965973-65965995 TAATTTAATTCACACCTTCCAGG + Intergenic
1042862629 8:73329439-73329461 CAATCTATTGCACACCTCCAAGG - Intergenic
1043673501 8:82919470-82919492 TAATTTAGTACTCACATACCAGG + Intergenic
1044330680 8:90916667-90916689 CATCTTATTCCACACCAACCTGG + Intronic
1046095014 8:109547378-109547400 GAAATTATTACATACCTACTGGG - Intronic
1046525400 8:115376502-115376524 TTATTTATTACACACCTGCTCGG + Intergenic
1047471337 8:125176190-125176212 CAATTTATTAAACAAAGACCTGG + Intronic
1048947447 8:139462507-139462529 CAATCTATTAAACAGCTTCCAGG + Intergenic
1049876633 8:145027348-145027370 CAATCTATTACACAGCTTTCAGG + Intergenic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1057031169 9:91776210-91776232 GAATTTATTACCCAGTTACCAGG - Intronic
1058935856 9:109768808-109768830 AAATTTAATACACACTTACATGG - Intronic
1059967950 9:119634579-119634601 AATTTTATTACACACATGCCAGG - Intergenic
1060073212 9:120569017-120569039 ACATGTATTACACACCTACTCGG + Intronic
1060199069 9:121641300-121641322 CCATTTAATTCCCACCTACCTGG + Intronic
1062487680 9:136788336-136788358 CAATCTATTACACAGCTTTCAGG + Intergenic
1186565694 X:10659917-10659939 CCATTTATTACAGACCTTCAAGG + Intronic
1191206957 X:57844581-57844603 CAAGTTCTTACAGACCTACAAGG + Intergenic
1191224792 X:58031595-58031617 CACTTTATTGCACAACTTCCTGG - Intergenic
1196168198 X:112557895-112557917 CAAGTTATTAGAGACCTACAAGG + Intergenic
1197586555 X:128354740-128354762 AAATTTATTTCACACATACCTGG - Intergenic
1197926697 X:131654667-131654689 AAATTTATTATCCACATACCAGG + Intergenic
1200257268 X:154590102-154590124 CAATCTATTACACAGCTTTCAGG - Intergenic
1200260502 X:154614300-154614322 CAATCTATTACACAGCTTTCAGG + Intergenic
1200753145 Y:6965387-6965409 CAATCTATTACACAGCTTTCAGG + Intronic