ID: 915738265

View in Genome Browser
Species Human (GRCh38)
Location 1:158098338-158098360
Sequence CTTCTGTAGGGGAAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915738258_915738265 -5 Left 915738258 1:158098320-158098342 CCTAGGTTTCAGGCACTCCTTCT 0: 1
1: 0
2: 4
3: 23
4: 261
Right 915738265 1:158098338-158098360 CTTCTGTAGGGGAAAATGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915738265 Original CRISPR CTTCTGTAGGGGAAAATGGG AGG Intronic
901510334 1:9715324-9715346 CTTCTGTGGGGGCACCTGGGAGG - Intronic
901850242 1:12010522-12010544 CTTCTCTGTGGGTAAATGGGGGG - Intronic
903287795 1:22287719-22287741 TCTCTGCAGGAGAAAATGGGTGG + Intergenic
903287980 1:22288843-22288865 TCTCTGTAGGAGAAAATGAGTGG + Intergenic
904631260 1:31844069-31844091 CTTCTGGAGGCCAAGATGGGAGG + Intergenic
905448531 1:38043110-38043132 CTTCTGTTGGGGAGAAGTGGAGG - Intergenic
906822750 1:48946528-48946550 TTTCTGCATTGGAAAATGGGTGG + Intronic
907987289 1:59544499-59544521 CTGCTTTAGGGGAGAATGGTGGG + Intronic
910871847 1:91841305-91841327 ATTCTATATGGTAAAATGGGAGG - Intronic
911254622 1:95619748-95619770 ATTCTGTAGGAAAAAATGGAAGG - Intergenic
913365609 1:118034735-118034757 CTTCTCTATGGGAAAATAGATGG + Intronic
915509957 1:156381482-156381504 CCCTTGTAGGGGAAGATGGGAGG + Exonic
915532722 1:156512502-156512524 CTACTGTAGATGAAAATAGGAGG + Intergenic
915738265 1:158098338-158098360 CTTCTGTAGGGGAAAATGGGAGG + Intronic
916012993 1:160723772-160723794 CTTCAGGTGGAGAAAATGGGCGG + Intergenic
917278966 1:173361100-173361122 CTTGTGAAGGAGGAAATGGGAGG + Intergenic
918224870 1:182472217-182472239 CTACTGTGGGGGAGAATTGGAGG - Intronic
919693519 1:200548692-200548714 CTTCTGGAGGCCAAGATGGGAGG - Intergenic
921822741 1:219636282-219636304 CTTTTGGAGGCCAAAATGGGAGG + Intergenic
922866441 1:228864961-228864983 CTTCTGTGGGAGAAGATGGAAGG + Intergenic
924078286 1:240363940-240363962 GTGCTTTAGGGGAAAGTGGGGGG + Intronic
1064134414 10:12738120-12738142 CATCTGTAGGTGACAATGTGTGG + Intronic
1064839400 10:19573574-19573596 CTTTTTTAGGGGGAAAGGGGTGG - Intronic
1065268396 10:24000914-24000936 GTTATGTGGGGGAAAATGTGTGG + Intronic
1068348925 10:55818869-55818891 CTTATGTATGGCAAATTGGGTGG - Intergenic
1069663903 10:70142557-70142579 CCTCTGTCTGGGAAAATGGTGGG - Intronic
1071601911 10:86962584-86962606 CTCCTGTAGGGGACAAAAGGGGG - Exonic
1071935008 10:90519753-90519775 CTTGTGGAGGGGATAATTGGTGG + Intergenic
1073499333 10:103921746-103921768 ATTCTGTAGGGGGAAAGTGGAGG + Intergenic
1074284302 10:112083513-112083535 CTGCAGAAGAGGAAAATGGGAGG - Intergenic
1075912967 10:126141814-126141836 CTTCTTTAGGGGAAATTTGTAGG + Intronic
1076257864 10:129042600-129042622 CAGCTGCTGGGGAAAATGGGAGG + Intergenic
1077633623 11:3827264-3827286 GGTCAGTAGCGGAAAATGGGAGG + Exonic
1079158203 11:17968443-17968465 CTTTTGTAGGCCAAAGTGGGAGG + Intronic
1081567649 11:44269890-44269912 TTTCTGTGGGGGAAGCTGGGGGG + Intronic
1085602870 11:77871046-77871068 CTTCAGGAGGCCAAAATGGGAGG - Intronic
1086688039 11:89755152-89755174 GTTCTGTAATGGAAAATGGTAGG - Intergenic
1087027438 11:93663355-93663377 CGTGTGTGAGGGAAAATGGGAGG - Intronic
1089725268 11:120472374-120472396 CTTCTTTAGGGAAAATTGAGGGG + Intronic
1089852956 11:121516172-121516194 CTACTGTAGGGGACAAAGGTGGG + Intronic
1092557518 12:9572456-9572478 CTTCTGGAGGCCAAAGTGGGTGG - Intergenic
1095085721 12:38056012-38056034 TTTCTGAAGGGGAAAAGGGAAGG - Intergenic
1095450780 12:42328424-42328446 CTTTTTTAGGGTAAAATGGAGGG + Intronic
1096464700 12:51841865-51841887 CTTCTTTTGAGGAAAAGGGGAGG - Intergenic
1096815995 12:54202103-54202125 CTTCTTTAAGGTAAAATGGTGGG - Intergenic
1097714822 12:62954984-62955006 CTTCTGTTTGAGAAAATCGGGGG - Intergenic
1098588307 12:72182184-72182206 CTTCTTCAGGAGAAAATGTGGGG - Intronic
1098915420 12:76252005-76252027 CTTTGGTAGGCCAAAATGGGTGG - Intergenic
1099238263 12:80108351-80108373 TTTCTGTAGTGGTAAGTGGGTGG + Intergenic
1100178294 12:92055964-92055986 CAAGTGTAGGGTAAAATGGGTGG + Intronic
1103203723 12:119111288-119111310 CTAGTGTAGGGAAAAATAGGGGG + Intronic
1103402409 12:120651984-120652006 GTTGTGTAAGGGAAGATGGGTGG - Intronic
1105492443 13:20902302-20902324 CTTCGGTAGGGGAAATTTGTAGG - Intronic
1105568323 13:21574195-21574217 CTTCTGAAGTGGAAAGTGGTGGG + Intronic
1106846747 13:33744956-33744978 CCACTGTAGGGGAGAAGGGGTGG + Intergenic
1107432344 13:40351599-40351621 CATCTGCAGGGGGAGATGGGGGG - Intergenic
1108704407 13:52972323-52972345 CTTCTGCAGTGCAAAATTGGTGG - Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1113179332 13:107607905-107607927 CTTCTGTAGAGGAAGATTAGGGG - Intronic
1114313284 14:21487431-21487453 TGTCTGTAGGGGAAAAAAGGGGG - Exonic
1116337776 14:43679921-43679943 CTGTTGTGGGGGAAAAAGGGAGG + Intergenic
1116616643 14:47148896-47148918 CATCTCTAGGGGAAAATAAGTGG - Intronic
1116657767 14:47673954-47673976 CTTCGGGAGGGGAAAATAGCAGG - Intronic
1117980874 14:61340801-61340823 GTTCTGACCGGGAAAATGGGAGG - Intronic
1118347447 14:64950459-64950481 ACTCTGTAGGGAAAATTGGGGGG - Intronic
1120055860 14:79923479-79923501 TTTCTGTAAGGGAAAGTGAGTGG + Intergenic
1121549250 14:94786193-94786215 CTTCTGGAGGCGAAGGTGGGAGG - Intergenic
1126879369 15:53078042-53078064 TTTCTGGAGGGGAAAAAGTGTGG + Intergenic
1129444290 15:75605900-75605922 CTTCGGTAGGCCAAAGTGGGTGG + Intronic
1129690583 15:77711065-77711087 ATTCTGGAGGGGAAGAAGGGAGG - Intronic
1129775124 15:78231527-78231549 CTTTGGTAGGACAAAATGGGTGG - Intronic
1130416722 15:83701384-83701406 CCTCTTTAGGGGAATATGGCTGG - Intronic
1130679862 15:85987243-85987265 CTTCTGTACATGAAGATGGGAGG + Intergenic
1133937639 16:10282093-10282115 TTTCTATGGGGGAAAATGAGGGG - Intergenic
1136343057 16:29657472-29657494 CTTCTGGAGGCGAAGATGAGAGG + Intergenic
1136773996 16:32861452-32861474 CTACTGGATGGGAACATGGGAGG + Intergenic
1136896613 16:34000067-34000089 CTACTGGATGGGAACATGGGAGG - Intergenic
1138269132 16:55682284-55682306 TTTCCGTATGGGAAAATGTGTGG + Intronic
1138589178 16:57990382-57990404 CATTTGGAGGGGACAATGGGTGG - Intergenic
1139210836 16:65075163-65075185 CTTGGATAGGGAAAAATGGGGGG + Intronic
1139723100 16:68873110-68873132 CTTCTTTGGGGGGACATGGGGGG - Intronic
1140298233 16:73729281-73729303 CTTCTGGAGGCCAAAGTGGGTGG + Intergenic
1203076418 16_KI270728v1_random:1123563-1123585 CTACTGGATGGGAACATGGGAGG + Intergenic
1142537156 17:626424-626446 CTTCGGGAGGCTAAAATGGGCGG + Intronic
1144626791 17:16848016-16848038 CTTCTGTGTGGGAGACTGGGGGG - Intergenic
1144879644 17:18424696-18424718 CTTCTGTGTGGGAGACTGGGGGG + Intergenic
1145152593 17:20519691-20519713 CTTCTGTGTGGGAGACTGGGGGG - Intergenic
1146163929 17:30573855-30573877 CTTCTGTGTGGGAGACTGGGGGG - Intergenic
1146182395 17:30706572-30706594 GCTCTGTAGGGGGAAGTGGGTGG + Intergenic
1146308099 17:31746121-31746143 CATCTGGAGTGGGAAATGGGAGG - Intergenic
1147439857 17:40441445-40441467 CCTTTGTAGGGAAGAATGGGTGG + Intergenic
1147550476 17:41438311-41438333 CTTCTGTAGTGGGAAATAAGGGG + Exonic
1147580935 17:41626709-41626731 CTTCTGTGTGGGAGACTGGGGGG - Intergenic
1147947175 17:44086735-44086757 CAGCTGGAGGGGAGAATGGGAGG + Exonic
1148898015 17:50851660-50851682 CATCTGCAGGGGAAATTGTGGGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151018357 17:70583846-70583868 CTTATGAAGGTGAAAATGGTAGG - Intergenic
1152700783 17:81817927-81817949 CTTCTGCAGTGGACAGTGGGAGG - Intergenic
1152857052 17:82671077-82671099 CTTCTGTAGTGGAAAGTCAGTGG - Intronic
1157482560 18:48064849-48064871 CTGCTCTAGAGGAAAATGGCAGG + Intronic
1158057247 18:53296319-53296341 CTACTTTAAGGGAAACTGGGAGG - Intronic
1161137054 19:2626141-2626163 CTTCTGTTTGGTAAAATGGGGGG - Intronic
1161954368 19:7484806-7484828 CCTCTGTGGGGAAAAATTGGAGG + Intronic
1162976429 19:14209229-14209251 GCTCTGTAGGGGGAAGTGGGTGG - Intergenic
1163104859 19:15117359-15117381 CTTCTGTAGGAACAAATGGTGGG - Intronic
1164614489 19:29658502-29658524 CCTCTGGAAGGGAAAATGGGTGG - Intergenic
1164965817 19:32481902-32481924 CTTCTGAAGGGGGAAAAGGATGG + Intronic
1168456407 19:56513107-56513129 CTTCTATAGGGCAAATTGGAGGG - Intronic
928016357 2:27661487-27661509 CTTCTGTAGTGAAAAATACGAGG + Intronic
928450987 2:31378501-31378523 CTTCTTCAGGGAAAAGTGGGTGG - Intronic
928756153 2:34528080-34528102 CTTCTTTAAGAGAAAATGGAAGG - Intergenic
930497445 2:52164662-52164684 CATGTGTAGGGGAAATTTGGGGG + Intergenic
931087128 2:58844921-58844943 CTTCTGGAGGGGAAAGAGGTGGG + Intergenic
934026285 2:88003763-88003785 AATCTGTTAGGGAAAATGGGGGG + Intergenic
936373759 2:111923799-111923821 CTTCTGTGGGGGAAAAACAGGGG + Intronic
936483228 2:112905158-112905180 ATTCAGTTGGGGAAAATGGGAGG - Intergenic
936913601 2:117617068-117617090 CTTGGGTAGGGGAGAATGGATGG + Intergenic
937863896 2:126733523-126733545 CGTCTGATGGGGAAGATGGGTGG + Intergenic
937877046 2:126833598-126833620 CCTCTGTAGGGGAACATAGGTGG + Intergenic
939768845 2:146289348-146289370 CTTCTGCAGGGGAGGATGGCTGG - Intergenic
942686116 2:178533787-178533809 CTTATGTAGGTGAAAATGTCCGG - Exonic
944911459 2:204314416-204314438 TACCTGTAGGGAAAAATGGGAGG + Intergenic
945962942 2:216154818-216154840 CTTATGCTGGGGATAATGGGAGG - Intronic
946047960 2:216836955-216836977 CTTCTCAAAGGGAAAATGGCTGG + Intergenic
1169189870 20:3651772-3651794 CTCCTGTAGGGGAAGATGGCAGG + Intergenic
1170865412 20:20150838-20150860 CATCTGTAGGGGAAGAGGGAAGG + Intronic
1171837917 20:30174398-30174420 CTTTTGTAGGCTGAAATGGGTGG - Intergenic
1173844696 20:46180471-46180493 CTTCTGCAGGGGAAGAAAGGGGG + Intronic
1175888436 20:62305191-62305213 CATCTGTAGGTGAAAACTGGTGG + Intronic
1176887242 21:14271483-14271505 CTTCTGTTGGGGAAAATAAATGG + Intergenic
1178677836 21:34646280-34646302 GTTATGTAGGGGAAAGTGTGAGG - Intergenic
1181001063 22:19987914-19987936 CTGCTGCAGTGAAAAATGGGAGG + Intronic
1182360373 22:29743035-29743057 CTTTTGGAGGCCAAAATGGGAGG - Intronic
949170999 3:996586-996608 CATTTGTAGGGGATGATGGGGGG - Intergenic
953124152 3:40075726-40075748 CTTCTGTAGAAGAAAGGGGGTGG + Intronic
953984316 3:47429590-47429612 CTTCGGGAGGCCAAAATGGGAGG - Intronic
954920728 3:54188602-54188624 CTGCTGTTGGAGCAAATGGGAGG + Intronic
954958116 3:54539931-54539953 CTTCTTTTAGGGAAAATGGATGG - Intronic
955087355 3:55716238-55716260 TTTCTGTGGGGGAAGCTGGGAGG - Intronic
955281966 3:57602426-57602448 CTTCTGGAAGGGAAAGTGGGTGG - Intergenic
955659716 3:61284662-61284684 ATTCTGTAGGGGAAACAGGAAGG + Intergenic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956909032 3:73797752-73797774 CTTGTGTGGGGCAGAATGGGGGG + Intergenic
958044645 3:88268620-88268642 TTTCTGTAACGGAAAATGGGTGG - Intergenic
958864272 3:99482923-99482945 CTTCTTTAGGGGAAAAGGGTAGG - Intergenic
960190596 3:114700537-114700559 CTGATGTAGTGGAAAATGAGTGG - Intronic
960433856 3:117601915-117601937 CTTCTTAAGTGGAAAATGGGTGG + Intergenic
961312733 3:126014042-126014064 CTTCTGTGGGGGCAGATGCGGGG + Intronic
964239314 3:154573549-154573571 CTTGTGGAGGGGACAATTGGTGG - Intergenic
969372114 4:6739230-6739252 CTTCGGGAGGCGAAAGTGGGTGG - Intergenic
969593703 4:8136313-8136335 CTTCTGTTTGGGAAGATGAGAGG + Intronic
969893819 4:10284346-10284368 TTTATGTAGGGGAAATTTGGGGG - Intergenic
973186462 4:47335421-47335443 CATTTGTTGGGGCAAATGGGAGG - Intronic
978365469 4:107976691-107976713 CTTCTAGAGGGGAAAAAAGGAGG - Intergenic
984651169 4:182272091-182272113 CTCATGTAGGTGGAAATGGGTGG - Intronic
989790158 5:45389330-45389352 ATACTGTAGGGTGAAATGGGGGG - Intronic
990031117 5:51260998-51261020 CTGGTGAAAGGGAAAATGGGGGG - Intergenic
991683537 5:69161404-69161426 CTTTGGTAGGCCAAAATGGGAGG + Intergenic
992399531 5:76399403-76399425 TTTCTGTTGGGGAAACTGTGTGG + Intergenic
994202200 5:96990235-96990257 CTTCTGTAGGGGAAAGATGCAGG + Intronic
994382878 5:99092445-99092467 CTTCTGTAGGCTTAAAAGGGAGG - Intergenic
995075751 5:107981085-107981107 CAACTGTGAGGGAAAATGGGAGG + Intronic
995360053 5:111286083-111286105 CTTCTGTAAGAGAAAAATGGAGG + Intronic
996461267 5:123745994-123746016 TTTCTGTAGAGGAAAGTGGCTGG + Intergenic
998368136 5:141644301-141644323 CTTCTGGAGGGGAGAATTTGGGG - Exonic
999342769 5:150787144-150787166 CTCCGGTAGGGGAAAATGACAGG + Intronic
999502748 5:152163221-152163243 CTTCTGGAGGCCAAGATGGGAGG - Intergenic
999619754 5:153460650-153460672 CTTGGCTGGGGGAAAATGGGAGG + Intergenic
1000102797 5:158032960-158032982 CTAATGTTGGGGAAAACGGGAGG - Intergenic
1001829620 5:174774511-174774533 TTTCTTTATGGTAAAATGGGAGG - Intergenic
1003440143 6:6133134-6133156 CTTCTGCACGGGAAAATGGGAGG + Intergenic
1004628971 6:17403723-17403745 CTTCTGTAGGGCAAGAAGCGTGG + Intronic
1006264793 6:32911616-32911638 CATCTGTTGGGGATGATGGGAGG - Intergenic
1007046257 6:38777674-38777696 CTTTTGTGGGGGGAGATGGGAGG - Intronic
1007746138 6:44044015-44044037 TTTCTGGAGGGGACAGTGGGAGG - Intergenic
1008927189 6:56899483-56899505 CTTCTGTGGGGGTAACTGTGTGG - Intronic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1011069604 6:83365614-83365636 CTTTAGGAGGGCAAAATGGGAGG + Intronic
1011716596 6:90111911-90111933 CTTCTGTGAGTGACAATGGGTGG + Intronic
1012047263 6:94293600-94293622 CTAATGTAGGGGAAAATGTTTGG + Intergenic
1012384206 6:98659101-98659123 CTTGTGTAGGGCACATTGGGTGG + Intergenic
1012678804 6:102153136-102153158 CTTATGCAGGGGAAAATCGAGGG - Intergenic
1013126579 6:107190318-107190340 CTGCTGCAGGAGAAAATCGGGGG - Intronic
1013509489 6:110831536-110831558 CTTCGGAAGGTGAAAGTGGGAGG - Intronic
1013592448 6:111630880-111630902 TATCTGAAGGGGAAAATGGAGGG - Intergenic
1014906081 6:127029751-127029773 ATTCTGAATGGGAAAATGGGTGG - Intergenic
1017057387 6:150449974-150449996 CTTCTGTAGGTGAATAAAGGTGG - Intergenic
1019326244 7:439679-439701 TTTATGTAGAGGAAACTGGGGGG + Intergenic
1020435767 7:8160918-8160940 TTTCTGGAGGGGAGAATCGGGGG + Intronic
1022172688 7:27844845-27844867 CTACTCTAGGGGAAAATGAGGGG + Intronic
1022517425 7:30984767-30984789 CTTGTGTAGGGGAACATTTGGGG - Intronic
1022787055 7:33648836-33648858 CTCCTTTAGGGGAGAATGGCTGG + Intergenic
1029360047 7:100081801-100081823 GTTCTGTCTAGGAAAATGGGAGG + Intronic
1031118088 7:117689931-117689953 GGACTGTAGGGGACAATGGGTGG + Intronic
1031493378 7:122417334-122417356 ATTCTGTAGGGGAATATAGTAGG - Intronic
1031733466 7:125327146-125327168 CTTCTTAATGGGAAAATGAGTGG - Intergenic
1032314709 7:130825036-130825058 ATGCTGTAGGGGAAAATAAGAGG - Intergenic
1032801239 7:135318710-135318732 CTTATTTAGGAAAAAATGGGAGG - Intergenic
1032906812 7:136377612-136377634 CTTCTGGAAGGGAAAAGAGGTGG - Intergenic
1034170654 7:149060549-149060571 ATTCTTTGGGGGAAAATGGCAGG - Intergenic
1036974290 8:13393582-13393604 CTACTGGAGTGGAAGATGGGAGG + Exonic
1038925919 8:32139276-32139298 CTTCTGAAGGGGAGAAATGGCGG - Intronic
1038928336 8:32165385-32165407 CTTTGGGAGGGCAAAATGGGAGG - Intronic
1039113374 8:34064740-34064762 CTTTTGGAGGCTAAAATGGGAGG - Intergenic
1041280055 8:56199732-56199754 CTCCTGTAGGGGAGGATCGGGGG - Intronic
1041703351 8:60816871-60816893 CTTCTGTTGGGGAAAGTATGTGG + Intronic
1042650531 8:71035796-71035818 CTGCTGCAGGGGAGAATGGCAGG - Intergenic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1043220319 8:77654671-77654693 AGTGTGAAGGGGAAAATGGGAGG - Intergenic
1043551548 8:81378748-81378770 CTTATGTAGGGGAGAAAGGTTGG + Intergenic
1044631743 8:94286899-94286921 CTACTGTAGAGAAAAAAGGGGGG + Intergenic
1044848022 8:96400473-96400495 CTAGTGTAGGGGAGAATGAGAGG + Intergenic
1045531330 8:102988034-102988056 CATCTGGAGGGGAAAATGTCTGG + Intergenic
1046171436 8:110512815-110512837 TTACTGGAGGGGAAAATGGTAGG - Intergenic
1047784240 8:128138298-128138320 GTTGTGTTGGGGAAAATGAGAGG + Intergenic
1051081500 9:13299683-13299705 CTTCTGGAGACGAAAGTGGGAGG - Intergenic
1051339788 9:16100831-16100853 CTTCTGTTGGGGCAGATGGGAGG + Intergenic
1051888880 9:21923562-21923584 CTGCTATAGGAGAAAGTGGGAGG - Intronic
1054951622 9:70858472-70858494 CTTCTGTCTGGGCAAAGGGGTGG - Intronic
1055344219 9:75317549-75317571 CATATGTAGGGGAAAAAAGGGGG - Intergenic
1055730146 9:79272504-79272526 CATCTGTAGGGTAATCTGGGAGG + Intergenic
1057164116 9:92913114-92913136 CTTCTGGTGGGGAAGAAGGGTGG - Intergenic
1058650002 9:107166810-107166832 CATCTGTAGAGGGAACTGGGTGG + Intergenic
1058983855 9:110194323-110194345 CTGCTGGAGGGGAAAAAGGGAGG + Intronic
1060995291 9:127872325-127872347 CTTCTGGAGTAGAAAATTGGGGG + Intronic
1061587862 9:131580004-131580026 CTTCTGGTGTGTAAAATGGGAGG + Intronic
1185722785 X:2395466-2395488 CCTCTCTATGGGAAAAAGGGAGG - Intronic
1185805065 X:3049656-3049678 CTTATTTAGGAGAAAATGGGAGG + Intronic
1186294006 X:8129052-8129074 TGTCTGGAGGGGAAAAAGGGAGG + Intergenic
1189305551 X:39984338-39984360 CTTCTGTTGGGGAAACTTTGAGG - Intergenic
1190196216 X:48320880-48320902 CTTCGGTAGGCCAAGATGGGAGG - Intergenic
1190456455 X:50632665-50632687 CTTCTGAAGTAGAAAATGGGAGG + Intronic
1191839599 X:65502188-65502210 CTTCTGGTGGGGGAAATGGGAGG - Exonic
1192875187 X:75222573-75222595 CTTCTGCCTGTGAAAATGGGAGG - Intergenic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1193358760 X:80555538-80555560 CTCCTGTAGGGAAAAGTGGTTGG + Intergenic
1193574657 X:83183315-83183337 CTTTTGTAGTGGGAACTGGGAGG - Intergenic
1196483280 X:116176192-116176214 CTTCTGTAGGAAAAGATAGGAGG + Intergenic
1198015741 X:132608873-132608895 CTTTTGTATGTGAAAATGTGAGG + Intergenic
1198658829 X:138944231-138944253 CTTCTGTAGGGAAGAATGGAGGG - Intronic
1198664123 X:139002979-139003001 CTTCTGTTTGGGAAAAGTGGAGG + Intronic
1199466542 X:148144447-148144469 CTTCTTTAGGTTGAAATGGGAGG + Intergenic
1201276195 Y:12300956-12300978 CTTATTTAGGAGAAAATGGGAGG - Intergenic
1201747283 Y:17391364-17391386 CTTTTGGAGGCCAAAATGGGAGG - Intergenic