ID: 915740933

View in Genome Browser
Species Human (GRCh38)
Location 1:158117956-158117978
Sequence GGATTCTCTGCAGCTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915740933_915740941 16 Left 915740933 1:158117956-158117978 CCAGGGGGAGCTGCAGAGAATCC No data
Right 915740941 1:158117995-158118017 AGCCCTGAGTGGTCTGTTTCTGG No data
915740933_915740944 22 Left 915740933 1:158117956-158117978 CCAGGGGGAGCTGCAGAGAATCC No data
Right 915740944 1:158118001-158118023 GAGTGGTCTGTTTCTGGTTCTGG No data
915740933_915740940 5 Left 915740933 1:158117956-158117978 CCAGGGGGAGCTGCAGAGAATCC No data
Right 915740940 1:158117984-158118006 CGGGGCAGCGCAGCCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915740933 Original CRISPR GGATTCTCTGCAGCTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr