ID: 915744080

View in Genome Browser
Species Human (GRCh38)
Location 1:158142807-158142829
Sequence GCCACTTAAGAGGGGGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744080_915744086 6 Left 915744080 1:158142807-158142829 CCTCTAGCCCCCTCTTAAGTGGC No data
Right 915744086 1:158142836-158142858 CAGATCCTCACTCAGTAACCAGG No data
915744080_915744089 12 Left 915744080 1:158142807-158142829 CCTCTAGCCCCCTCTTAAGTGGC No data
Right 915744089 1:158142842-158142864 CTCACTCAGTAACCAGGGCTTGG No data
915744080_915744087 7 Left 915744080 1:158142807-158142829 CCTCTAGCCCCCTCTTAAGTGGC No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744080 Original CRISPR GCCACTTAAGAGGGGGCTAG AGG (reversed) Intergenic
No off target data available for this crispr