ID: 915744082

View in Genome Browser
Species Human (GRCh38)
Location 1:158142815-158142837
Sequence TGGCACTTGCCACTTAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744082_915744091 26 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744082_915744087 -1 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data
915744082_915744086 -2 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744086 1:158142836-158142858 CAGATCCTCACTCAGTAACCAGG No data
915744082_915744089 4 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744089 1:158142842-158142864 CTCACTCAGTAACCAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744082 Original CRISPR TGGCACTTGCCACTTAAGAG GGG (reversed) Intergenic
No off target data available for this crispr