ID: 915744084

View in Genome Browser
Species Human (GRCh38)
Location 1:158142817-158142839
Sequence TCTGGCACTTGCCACTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744084_915744091 24 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744084_915744089 2 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744089 1:158142842-158142864 CTCACTCAGTAACCAGGGCTTGG No data
915744084_915744086 -4 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744086 1:158142836-158142858 CAGATCCTCACTCAGTAACCAGG No data
915744084_915744087 -3 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744084 Original CRISPR TCTGGCACTTGCCACTTAAG AGG (reversed) Intergenic