ID: 915744087

View in Genome Browser
Species Human (GRCh38)
Location 1:158142837-158142859
Sequence AGATCCTCACTCAGTAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744083_915744087 -2 Left 915744083 1:158142816-158142838 CCCTCTTAAGTGGCAAGTGCCAG No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data
915744080_915744087 7 Left 915744080 1:158142807-158142829 CCTCTAGCCCCCTCTTAAGTGGC No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data
915744082_915744087 -1 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data
915744084_915744087 -3 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data
915744081_915744087 0 Left 915744081 1:158142814-158142836 CCCCCTCTTAAGTGGCAAGTGCC No data
Right 915744087 1:158142837-158142859 AGATCCTCACTCAGTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744087 Original CRISPR AGATCCTCACTCAGTAACCA GGG Intergenic
No off target data available for this crispr