ID: 915744091

View in Genome Browser
Species Human (GRCh38)
Location 1:158142864-158142886
Sequence GATTCTGTTAGTGTACGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744081_915744091 27 Left 915744081 1:158142814-158142836 CCCCCTCTTAAGTGGCAAGTGCC No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744085_915744091 6 Left 915744085 1:158142835-158142857 CCAGATCCTCACTCAGTAACCAG No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744082_915744091 26 Left 915744082 1:158142815-158142837 CCCCTCTTAAGTGGCAAGTGCCA No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744083_915744091 25 Left 915744083 1:158142816-158142838 CCCTCTTAAGTGGCAAGTGCCAG No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744084_915744091 24 Left 915744084 1:158142817-158142839 CCTCTTAAGTGGCAAGTGCCAGA No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data
915744088_915744091 0 Left 915744088 1:158142841-158142863 CCTCACTCAGTAACCAGGGCTTG No data
Right 915744091 1:158142864-158142886 GATTCTGTTAGTGTACGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744091 Original CRISPR GATTCTGTTAGTGTACGTTG TGG Intergenic
No off target data available for this crispr