ID: 915744199

View in Genome Browser
Species Human (GRCh38)
Location 1:158143508-158143530
Sequence AAGGGAAAACAGAAGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915744198_915744199 -6 Left 915744198 1:158143491-158143513 CCAGAATATGCACTCTTAAGGGA No data
Right 915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG No data
915744193_915744199 23 Left 915744193 1:158143462-158143484 CCAAAATGGCCTGAATCTCGAAC No data
Right 915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG No data
915744194_915744199 14 Left 915744194 1:158143471-158143493 CCTGAATCTCGAACTTACCTCCA No data
Right 915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG No data
915744195_915744199 -3 Left 915744195 1:158143488-158143510 CCTCCAGAATATGCACTCTTAAG No data
Right 915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915744199 Original CRISPR AAGGGAAAACAGAAGAAGAA TGG Intergenic
No off target data available for this crispr