ID: 915747719

View in Genome Browser
Species Human (GRCh38)
Location 1:158177708-158177730
Sequence CAGCGCTATGGGCTCTCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915747719_915747735 19 Left 915747719 1:158177708-158177730 CCGCACGAGAGCCCATAGCGCTG 0: 1
1: 1
2: 1
3: 11
4: 67
Right 915747735 1:158177750-158177772 CCGACATCTTAAACTCCCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915747719 Original CRISPR CAGCGCTATGGGCTCTCGTG CGG (reversed) Intergenic
901012455 1:6209436-6209458 CAGCGCGATGGCCTCCCGCGTGG - Exonic
902314017 1:15604059-15604081 CAGCGCTTTGGGATCACTTGAGG + Intergenic
907023787 1:51095135-51095157 CAGGGCAATGGGCTCCCCTGTGG - Intergenic
911981157 1:104568657-104568679 CAGGGCTATGGCCTCTCCTCTGG - Intergenic
913334899 1:117700428-117700450 CAGAGCTGTGAGCTCTTGTGTGG + Intergenic
915747719 1:158177708-158177730 CAGCGCTATGGGCTCTCGTGCGG - Intergenic
915907956 1:159893010-159893032 CAGAGCTTTGGGATCTAGTGGGG - Intronic
923715632 1:236422737-236422759 CAGCACTATGGGCTCTGGTGAGG + Intronic
1066565422 10:36717006-36717028 CAGAGCTGTGGGTTCTTGTGGGG + Intergenic
1070678747 10:78434147-78434169 CAGCGCTGATGGCTCTTGTGGGG - Intergenic
1072877703 10:99190879-99190901 CAGGGCTATGGGCTCCCCTCTGG - Intronic
1074859526 10:117499757-117499779 CAGGGCTCTGGGCTCTCCAGTGG + Intergenic
1083176579 11:60953811-60953833 CAGGACCATGTGCTCTCGTGAGG + Intergenic
1091138770 11:133217552-133217574 CACCTCCATGGGCTCTCGTGTGG - Intronic
1091767928 12:3133982-3134004 CAGCGCTTAGGGCTGTTGTGAGG + Intronic
1095954591 12:47798866-47798888 CAGCAATGTGGGCTCTGGTGGGG + Exonic
1105323906 13:19352988-19353010 AAGAGCTATGGGCTCTTGTGGGG - Intergenic
1105870047 13:24496545-24496567 AAGAGCTATGGGCTCTTGTGGGG + Intronic
1106221285 13:27748391-27748413 CCGCTCCATGGGCTCTTGTGCGG - Intergenic
1107436314 13:40383366-40383388 CAGCCCAGTGGGCTCTCCTGTGG - Intergenic
1107807846 13:44171805-44171827 CAGGGCTGTGGGCTCCCCTGGGG + Intergenic
1112502683 13:99955166-99955188 CAGTGCTCTGGGCTCTCAGGAGG - Intergenic
1121909615 14:97777044-97777066 CAGGGCTGTGGGCTGTCCTGGGG + Intergenic
1202843673 14_GL000009v2_random:147381-147403 CAGCACTATGGGCTGTGGTGGGG + Intergenic
1202913076 14_GL000194v1_random:137623-137645 CAGCACTATGGGCTGTGGTGGGG + Intergenic
1202879574 14_KI270722v1_random:45060-45082 CGGCACTATGGGCTATGGTGGGG - Intergenic
1123994114 15:25706417-25706439 CAGTGTTTTGGGCTCTTGTGAGG - Intronic
1129208670 15:74052783-74052805 CCCCGCTATGGGCTCCTGTGCGG + Intergenic
1129237790 15:74234178-74234200 CAGAACTATGGGCTCTCTAGTGG + Intergenic
1129786598 15:78314050-78314072 CAGGGCTGTGGGCTGGCGTGAGG + Intergenic
1131450705 15:92537291-92537313 CAGTCCTTTGGGCTCTGGTGAGG + Intergenic
1134187523 16:12096469-12096491 CAGCACCATGGGCTGTTGTGAGG + Intronic
1139776815 16:69321535-69321557 CAGCACTGTGTGCTCTTGTGCGG + Intronic
1147135389 17:38431275-38431297 CAGTGCTATGGGCTAGCATGGGG - Intronic
1149334745 17:55624103-55624125 CAGCGCCATGGAGTCTCATGTGG - Intergenic
1154940735 18:21111154-21111176 CGGCGCTGTCGGCTGTCGTGAGG - Exonic
1162987136 19:14277890-14277912 CAACGCCATGGCCTCTTGTGCGG + Intergenic
1166278667 19:41774630-41774652 CAGTGCTATGTGCTCTGGTCTGG - Intergenic
1202655193 1_KI270708v1_random:14066-14088 CGGCACTATGGGCTATGGTGGGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
936537793 2:113325173-113325195 GAGCGCCGTGGGCTCTGGTGGGG - Intergenic
936977317 2:118232750-118232772 CAGCGATAGGGGCTCAGGTGGGG + Intergenic
937552164 2:123107692-123107714 CAGGGCAGTGGGCTCTCCTGTGG + Intergenic
938409297 2:131050821-131050843 GAGTGCTGTGGGCTCTGGTGGGG - Exonic
942734687 2:179096692-179096714 CAGAGCAATGGGCTCTCCTCTGG + Intergenic
1172502536 20:35437446-35437468 CGGCTCCTTGGGCTCTCGTGGGG + Exonic
1176632429 21:9152295-9152317 CAGCACTATGGGCTGTGGTGGGG + Intergenic
1176872213 21:14093046-14093068 CTGCGCCATGGGCTCCTGTGTGG - Intergenic
1180349904 22:11791903-11791925 CGGCACTATGGGCTATGGTGGGG - Intergenic
1184749622 22:46477877-46477899 CAGCACTGTGGACTCTCGTGGGG + Intronic
955811444 3:62794963-62794985 GAGCGCTATGGGTTCTCAGGGGG + Intronic
956747957 3:72324313-72324335 CAGCGCTGTGGTATCTGGTGGGG - Intergenic
1202755768 4_GL000008v2_random:60792-60814 CAGCACTATGGGCTGTGGTGGGG - Intergenic
989559719 5:42836653-42836675 CAGCCCTGTGGGCTCCCATGCGG + Intronic
994107298 5:95961663-95961685 CAGCGCTATGGGCTGTCGTGCGG - Exonic
997691458 5:135830244-135830266 CAGCGCTTGAGGCTCTCGGGCGG - Intergenic
997832675 5:137164670-137164692 CAGGGCAATGGGCTCTCCTTTGG - Intronic
998131557 5:139653891-139653913 CAGCACTAGGGGCTCTAGAGAGG + Intronic
999731846 5:154481208-154481230 CAGCCCTAAGGGATCTCCTGAGG + Intergenic
1003025978 6:2556245-2556267 CAGAGCAATGGGATCACGTGGGG + Intergenic
1005492049 6:26356054-26356076 CAGCACTATGGGATGTCGAGAGG - Intergenic
1006351055 6:33521585-33521607 CCACGCGATGGGCTCCCGTGAGG - Intergenic
1009785883 6:68338836-68338858 CTGGGTTATGGGCTCTCTTGGGG - Intergenic
1014724129 6:124955386-124955408 CAGCGCTCTGGGTTGTCATGGGG - Intergenic
1020135521 7:5585897-5585919 CAGGGCTTTGGGCCCTCTTGGGG + Intergenic
1029475253 7:100779556-100779578 CAGCGCTCCGGGCTCCTGTGTGG + Exonic
1030227538 7:107169394-107169416 CGGCGCTAGGGGGTCTCGGGCGG + Intronic
1033541959 7:142365530-142365552 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1049547541 8:143240510-143240532 CAGGGCGATGGGCTCTCCAGGGG + Intergenic
1057516852 9:95729225-95729247 CAGCCCTACGGGCTCCCGCGGGG - Intergenic
1061915568 9:133751410-133751432 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1062726587 9:138077458-138077480 CAGTGCTATGGGCAGTCATGTGG + Intronic
1203755259 Un_GL000218v1:119919-119941 CAGCACTATGGGCTGTGGTGGGG + Intergenic
1203536574 Un_KI270743v1:45629-45651 CAGCACTATGGGCTGTGGTGGGG - Intergenic
1187534978 X:20133291-20133313 CAGCGCTATGGATTATTGTGAGG + Intronic
1192400269 X:70827490-70827512 CAGGGCAGTGGGCTCTCCTGTGG - Intronic
1196365046 X:114914582-114914604 CAGGGATATGGGTTCTGGTGGGG + Intergenic
1196466246 X:115973892-115973914 CAGCACTCTGGGCCCTCCTGGGG + Intergenic
1197435626 X:126425044-126425066 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1199942005 X:152636851-152636873 TTGCCCTATGGGCTCTGGTGAGG + Intergenic
1201168875 Y:11237527-11237549 CAGCACTATGGGCTGTGGTGGGG + Intergenic