ID: 915752598

View in Genome Browser
Species Human (GRCh38)
Location 1:158226272-158226294
Sequence AGGTGGAAGGCTCTGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915752598_915752610 24 Left 915752598 1:158226272-158226294 CCCCACCTCAGAGCCTTCCACCT No data
Right 915752610 1:158226319-158226341 TAGGCACACACCACCACACCTGG 0: 117
1: 1563
2: 7688
3: 26790
4: 63319
915752598_915752603 -8 Left 915752598 1:158226272-158226294 CCCCACCTCAGAGCCTTCCACCT No data
Right 915752603 1:158226287-158226309 TTCCACCTCAGACACCCAAATGG No data
915752598_915752606 5 Left 915752598 1:158226272-158226294 CCCCACCTCAGAGCCTTCCACCT No data
Right 915752606 1:158226300-158226322 ACCCAAATGGCTGAGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915752598 Original CRISPR AGGTGGAAGGCTCTGAGGTG GGG (reversed) Intergenic
No off target data available for this crispr