ID: 915752887

View in Genome Browser
Species Human (GRCh38)
Location 1:158228452-158228474
Sequence AGCACAGAGGTCTCTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915752887_915752897 6 Left 915752887 1:158228452-158228474 CCCTGGGGAGAGACCTCTGTGCT No data
Right 915752897 1:158228481-158228503 AAGGGGAGGGAAGAATAGGAAGG 0: 3
1: 27
2: 151
3: 530
4: 2156
915752887_915752895 -7 Left 915752887 1:158228452-158228474 CCCTGGGGAGAGACCTCTGTGCT No data
Right 915752895 1:158228468-158228490 CTGTGCTTGAGGAAAGGGGAGGG No data
915752887_915752896 2 Left 915752887 1:158228452-158228474 CCCTGGGGAGAGACCTCTGTGCT No data
Right 915752896 1:158228477-158228499 AGGAAAGGGGAGGGAAGAATAGG No data
915752887_915752898 20 Left 915752887 1:158228452-158228474 CCCTGGGGAGAGACCTCTGTGCT No data
Right 915752898 1:158228495-158228517 ATAGGAAGGATTTTGTCTTGTGG No data
915752887_915752894 -8 Left 915752887 1:158228452-158228474 CCCTGGGGAGAGACCTCTGTGCT No data
Right 915752894 1:158228467-158228489 TCTGTGCTTGAGGAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915752887 Original CRISPR AGCACAGAGGTCTCTCCCCA GGG (reversed) Intergenic
No off target data available for this crispr