ID: 915754618

View in Genome Browser
Species Human (GRCh38)
Location 1:158248063-158248085
Sequence AGTCAAGATGAACCCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915754618_915754620 19 Left 915754618 1:158248063-158248085 CCATGTGGGGGTTCATCTTGACT No data
Right 915754620 1:158248105-158248127 CTGTAAGAGATGTGCGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915754618 Original CRISPR AGTCAAGATGAACCCCCACA TGG (reversed) Intergenic
No off target data available for this crispr