ID: 915759479

View in Genome Browser
Species Human (GRCh38)
Location 1:158296050-158296072
Sequence ACTCACATGCTGGTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915759479 Original CRISPR ACTCACATGCTGGTGGTGGT GGG (reversed) Intergenic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
900806155 1:4769590-4769612 ACTGACAGGGTGGTGGTGGAAGG + Intronic
901284335 1:8064941-8064963 ACTTACCTGGTTGTGGTGGTGGG + Intergenic
902472830 1:16661067-16661089 ACTCACATGCTGGTGAAGAAGGG - Intergenic
902485973 1:16746376-16746398 ACTCACATGCTGGTGAAGAAGGG + Intronic
902687318 1:18086894-18086916 ACTCTGATGGTGGTGGTAGTTGG - Intergenic
903018503 1:20377440-20377462 ACTCACATGGGGGTAGCGGTGGG + Intergenic
903377726 1:22876976-22876998 ACTCAGCTGCTGGTGGAGGCAGG - Intronic
904243301 1:29165948-29165970 ACTCACATCCTGCTGATGGTTGG - Intronic
904484291 1:30814655-30814677 ACTCAGATGGTGCTGGGGGTGGG - Intergenic
904609412 1:31716802-31716824 AGGCACATACTGGGGGTGGTGGG - Intergenic
905408985 1:37755349-37755371 ACTCACATGATGGTGGTGGTGGG - Intronic
905814433 1:40938290-40938312 GCTCACCAGCTGGTGATGGTGGG - Intergenic
906522029 1:46473023-46473045 GCTAACATGCTGGTGGAGGTGGG + Intergenic
907048839 1:51316236-51316258 ACTCAAAGGATGGAGGTGGTTGG - Intronic
907410496 1:54280097-54280119 GGTCACATGATGGTGGTGGGAGG - Intronic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
908856920 1:68440847-68440869 ACTCACCTGCTTGCAGTGGTGGG + Exonic
909499641 1:76319850-76319872 ACAGACATGCTGGTAGGGGTGGG - Intronic
910203740 1:84726304-84726326 AGCCACATGCTGAGGGTGGTAGG + Intergenic
912703301 1:111894495-111894517 TCTTACATGCTGGTGATAGTGGG - Intronic
913243825 1:116853959-116853981 ACTCAGAAGTTGGTGGGGGTGGG - Intergenic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
918077710 1:181183027-181183049 ACTTACTTTCTGGTGGTGGTGGG - Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
918962834 1:191302818-191302840 ACTCTGGTGCGGGTGGTGGTAGG + Intergenic
920577824 1:207074910-207074932 ATTCTCACACTGGTGGTGGTGGG - Exonic
922165301 1:223110654-223110676 GCTCTCATCATGGTGGTGGTTGG - Exonic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922603774 1:226876091-226876113 ACTCACGGGCAGGTGGGGGTGGG - Intronic
922771257 1:228184558-228184580 ACTCACACACTGCTGGTGGAAGG - Intergenic
923380397 1:233411563-233411585 ACTTCCTTGCTGGTGTTGGTGGG + Intergenic
923575787 1:235157902-235157924 ACTTGGATTCTGGTGGTGGTGGG - Intronic
1063380654 10:5583532-5583554 AGGCACATGCTGGTGGTGCATGG + Intergenic
1065633773 10:27709764-27709786 TCCCAAATGGTGGTGGTGGTGGG - Intronic
1066058950 10:31705800-31705822 ACTCAAGAGCTGGTGGAGGTTGG - Intergenic
1066520647 10:36214435-36214457 ACTCACATAAAGGTGGGGGTGGG - Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1069783866 10:70975593-70975615 ACTGGCATGGTGGTGGGGGTGGG - Intergenic
1069860376 10:71467509-71467531 CCTCACAGGCTGGTGGTGCTGGG - Intronic
1070572178 10:77648572-77648594 ACTAACAGGCAGGTGGTGGGTGG + Intergenic
1070723916 10:78775174-78775196 AATCCCATGGTGGTGGGGGTGGG - Intergenic
1072062350 10:91825857-91825879 ACTCAAATGTTGCTGGTGGCTGG + Intronic
1072269791 10:93765310-93765332 ACTCAAATGCTAGTGGGGTTTGG + Intronic
1072924544 10:99605088-99605110 ACTCACATGGTTGTGGGGGCTGG - Intergenic
1075061277 10:119258744-119258766 ACTCCCCTGCTGGAGGTGGGGGG - Intronic
1075426432 10:122345272-122345294 ACTCATATGCTGCTAGTGGGAGG + Intergenic
1075529623 10:123218439-123218461 ACTGACACCTTGGTGGTGGTGGG + Intergenic
1076005497 10:126945271-126945293 GCTCACATGGTGGTGTTGGCAGG + Intronic
1076471930 10:130725048-130725070 ACACACGTGCTGGAGGGGGTGGG - Intergenic
1077102590 11:828756-828778 ACTCACCTGCAGGTCGTGCTTGG - Exonic
1077226954 11:1442753-1442775 CCCCACAGCCTGGTGGTGGTGGG + Intronic
1080979642 11:37385883-37385905 AAAAACATGCTGGTGGTGGGGGG + Intergenic
1081981184 11:47268339-47268361 ACTCACATGGGGATGGTGGATGG - Exonic
1082249065 11:49960110-49960132 ACTCAAGTGCTGGTGGTGATAGG - Intergenic
1083128228 11:60595162-60595184 ATTCACATGCTGGTTGCTGTGGG - Intergenic
1084913028 11:72406619-72406641 ACTCTCAAGCTGGTAGTGGCAGG + Intronic
1085688883 11:78649763-78649785 ACTCACATGGGTTTGGTGGTGGG - Intergenic
1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG + Intronic
1085731387 11:79002025-79002047 ACACATGTGCTGGTGGGGGTGGG - Intronic
1085856440 11:80181414-80181436 TCTCACATGCTGGTGGGGTAAGG + Intergenic
1086399249 11:86447261-86447283 CCTCTTCTGCTGGTGGTGGTGGG + Intronic
1086511156 11:87559587-87559609 ACTCCCAAGATGGTGGTGGGCGG + Intergenic
1087647390 11:100824138-100824160 ACCCACATGCTGCCGGTGGGTGG - Intronic
1088566043 11:111174038-111174060 ACTACCAGGCTGGGGGTGGTGGG - Intergenic
1089405837 11:118196672-118196694 GCTCAGGTGGTGGTGGTGGTGGG - Intronic
1090358977 11:126159858-126159880 ACTTACAGGCTGGATGTGGTGGG - Intergenic
1091225313 11:133953594-133953616 ACTCAGATCCTGCTGGTAGTTGG - Intronic
1091704385 12:2683948-2683970 ACTGACATGCTGGGAGGGGTCGG - Intronic
1092091511 12:5807652-5807674 TCTCACCTGATGGTGGTGGAAGG - Intronic
1092779076 12:11968697-11968719 CCTCCCATGGTGGTGGAGGTGGG + Intergenic
1093892903 12:24545163-24545185 ACACATATGGTGGTGGTGATGGG - Intergenic
1096548046 12:52354790-52354812 ATTCTGATGCAGGTGGTGGTCGG - Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1098779340 12:74665420-74665442 ACTCACATGTTTGTGGTGATGGG - Intergenic
1099450359 12:82800619-82800641 ACTCAAATTTTGGTGGTGGGAGG - Intronic
1100144584 12:91662113-91662135 ACTCACGTGATGCTGGTAGTTGG - Intergenic
1100879781 12:99003908-99003930 ACTCTCATGCTGCTGGGGGATGG + Intronic
1102084780 12:110126848-110126870 ACTCAGATGCAGTTGGTTGTGGG + Intronic
1102748450 12:115271125-115271147 ACTCACATTCTGGGGGTGGAGGG - Intergenic
1102824938 12:115941099-115941121 ACTAAGAAGCTGGTGGAGGTTGG + Intergenic
1104021059 12:124992869-124992891 CCCCACATGCTGGAGTTGGTTGG + Intergenic
1104568932 12:129908507-129908529 ATTCATTAGCTGGTGGTGGTTGG - Intergenic
1104842858 12:131832888-131832910 GCTCACATGCTCACGGTGGTGGG - Intronic
1105330676 13:19412497-19412519 ACTCATCTGTTGGTGGTGGGTGG - Intergenic
1105956555 13:25288233-25288255 TCTCAAATGGTGGTGGTGGGGGG + Intergenic
1106432937 13:29698968-29698990 TCTCAAATGCTGGTTGTGGTAGG - Intergenic
1107823665 13:44308384-44308406 ATTCACATGCTTATGGAGGTTGG + Intergenic
1108624121 13:52210826-52210848 ACTCATCTGTTGGTGGTGGTGGG - Intergenic
1109643940 13:65227788-65227810 GCTCACATGATGGTGATGCTGGG + Intergenic
1111823760 13:93243931-93243953 ACTCAGATGTTGCTGGTGATGGG + Intronic
1113872296 13:113566717-113566739 AGACACAGGCTGGTGGTGATAGG - Intergenic
1113884530 13:113651759-113651781 CCTCACATGGCGGTGGGGGTGGG - Intronic
1116468898 14:45264884-45264906 ACTCACATACTGCTGCTGGTAGG - Intergenic
1116958436 14:50946251-50946273 TCACACATGGTGGTGGTGGGGGG + Intergenic
1117559641 14:56923628-56923650 ATTCACATGTTGGTGGTATTTGG + Intergenic
1117572126 14:57058020-57058042 ACTCAGATGCAGTTGGGGGTTGG - Intergenic
1117674601 14:58142956-58142978 ACTCATGTGGTGGTGGTAGTTGG - Intronic
1118982140 14:70725510-70725532 ACTCAGGTGCTGGTGTTGGAAGG - Intronic
1119738399 14:76998702-76998724 ACTCACAGGTTGGTTGTGGCAGG - Intergenic
1122386877 14:101354849-101354871 ACACACATGGTTGTGGTTGTGGG - Intergenic
1123918740 15:25055919-25055941 CCTCACGTGCTGGTTGTGGTTGG + Intergenic
1124087835 15:26568403-26568425 TCTGTCATGGTGGTGGTGGTAGG - Intronic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1125922613 15:43534529-43534551 AATCACATGTTGCTGGTGGAAGG + Exonic
1126516020 15:49539067-49539089 ATTTACATGCTGGTTTTGGTGGG + Intronic
1126782673 15:52151657-52151679 ACTCACATACTGCTGTTGGGAGG - Intronic
1127211866 15:56781811-56781833 ACTGTCATGGTGCTGGTGGTGGG - Intronic
1128785529 15:70394167-70394189 TCTCCCCTGATGGTGGTGGTGGG + Intergenic
1129703358 15:77780773-77780795 CCTCACATGGTGGGGGTGGGGGG - Intronic
1130644095 15:85708472-85708494 ATTGACCTGCTGGTGGGGGTGGG + Intronic
1132263849 15:100449030-100449052 ACGCATGTGCTGGTTGTGGTAGG - Intronic
1133299751 16:4775119-4775141 ACTCAGATGTTGGTCGTGGGTGG + Intergenic
1135358047 16:21786637-21786659 ACTCAATTGCTAGTTGTGGTTGG - Intergenic
1135456552 16:22602761-22602783 ACTCAATTGCTAGTTGTGGTTGG - Intergenic
1136050555 16:27647010-27647032 ACTCACAAGCTGTGGGTGGGAGG - Intronic
1138356326 16:56383886-56383908 AGTCCCCTGGTGGTGGTGGTGGG + Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1138577466 16:57917242-57917264 AGTCACAGGCAGGTGGTGTTGGG - Intronic
1139195942 16:64918582-64918604 ACTCTCCTGCAGGTGGTGCTGGG - Intergenic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1140213835 16:72991889-72991911 AATCACAGGCTCGTGCTGGTTGG - Intronic
1140873659 16:79130151-79130173 AGTCACAGGCTGGTGGAGTTGGG + Intronic
1143163761 17:4887257-4887279 ACTCTCAGCCTGGGGGTGGTGGG + Intronic
1143726288 17:8849017-8849039 ACACACATCTTGGTGGGGGTTGG + Intronic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1144037499 17:11380832-11380854 ACTCACATGGTGCTGGATGTTGG + Intronic
1144379926 17:14684700-14684722 ACTTACATACTGTTGGTGGGAGG - Intergenic
1144425307 17:15135697-15135719 ACTCAGGTGCTGTTGGTGGGTGG - Intergenic
1146115227 17:30130982-30131004 ATTCTCAAGGTGGTGGTGGTGGG + Intronic
1148177596 17:45581161-45581183 ACTCACATCCGGGGGGTGGGGGG + Intergenic
1148291506 17:46455211-46455233 ACTTAGATGCTGGTAGTGCTTGG + Intergenic
1148313694 17:46672913-46672935 ACTTAGATGCTGGTAGTGCTTGG + Intronic
1149536281 17:57436006-57436028 ACTTCCATGCTGGAGGTGGAGGG + Intronic
1150054912 17:62005795-62005817 ACTCCTATGCTGATAGTGGTGGG - Intronic
1150066305 17:62112208-62112230 ACTCACCTTCTGGTGCTTGTAGG + Intergenic
1151049111 17:70956648-70956670 GCTCACATGATGGTGGAGGCTGG + Intergenic
1151338670 17:73455900-73455922 ACTCACATGCGGCTGCTGGGCGG + Exonic
1152079558 17:78178267-78178289 CTTCAGATGCTGGTGGTGGGTGG - Intronic
1153404325 18:4719040-4719062 ACTGACATTCCTGTGGTGGTGGG + Intergenic
1156209436 18:34923080-34923102 ACCCACAGGCTTGTAGTGGTAGG - Intergenic
1156240312 18:35247337-35247359 ACTTCCATGAGGGTGGTGGTGGG + Exonic
1156451111 18:37266921-37266943 ACTGAGATGCTGGTGGTGGGGGG + Intronic
1156576481 18:38322758-38322780 TCTTGCAAGCTGGTGGTGGTGGG + Intergenic
1157955920 18:52097625-52097647 ATTCACATTATGTTGGTGGTGGG - Intergenic
1159271938 18:66164209-66164231 ACTGACATGTTGGAGGTGGGAGG - Intergenic
1159857123 18:73602241-73602263 ACTCACAAGCTTCTAGTGGTGGG + Intergenic
1162673385 19:12278098-12278120 ACGCACATGCTGAAGGTTGTTGG + Intronic
1163134440 19:15299461-15299483 AGTCCCTTGGTGGTGGTGGTGGG + Intronic
1163179913 19:15592023-15592045 ACTCCCAGGCTGGTGGTGCCAGG + Intergenic
1164120275 19:22259728-22259750 ACTCACATCATGTTGGTGGTGGG + Intergenic
1164179984 19:22809902-22809924 ACTCACATCATGTTGGTGGTGGG - Intergenic
1164293490 19:23888359-23888381 ACTCACATCATGTTAGTGGTGGG - Intergenic
1164436410 19:28233862-28233884 ATTCCCATGCTTGGGGTGGTGGG + Intergenic
1167463832 19:49639992-49640014 ACACACAAGCTGGTGGTCGTGGG - Exonic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
1168433012 19:56296095-56296117 ACTCACAGTCTAGTGGAGGTGGG + Intronic
925570123 2:5301473-5301495 ACACAGATGGTGGTGGTGGTGGG - Intergenic
925720137 2:6819558-6819580 ACACACATGCTGGTGTTCATTGG + Intergenic
926449600 2:12986313-12986335 TCCCACATGCTGGTTGTGATAGG + Intergenic
926649499 2:15326855-15326877 ACTCACATGCTGCTGGAGAGAGG - Intronic
927805788 2:26145381-26145403 TCTGCCATGCTGGTGGGGGTAGG - Intergenic
931653744 2:64491282-64491304 ACTTACATTCTAGTGGTGGGGGG + Intergenic
931764191 2:65440089-65440111 CATCACATGGTGGTGGTGGCAGG + Intergenic
932475449 2:72003115-72003137 ACTCACCTCCTTGTGGTTGTGGG - Intergenic
932777219 2:74535582-74535604 ACTCACCTGCAGGCCGTGGTTGG + Exonic
933204297 2:79487637-79487659 ACTCACATGATGGTGGCTGAAGG - Intronic
933793467 2:85902158-85902180 ACTCACAGGCTGGGGGATGTTGG - Intergenic
936927698 2:117754580-117754602 ACACACATGCTGGAGTTGGTGGG + Intergenic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
937473567 2:122194477-122194499 AAACCCATGCTGGTTGTGGTGGG + Intergenic
937659544 2:124414852-124414874 ACTCACATGCCTGGGGAGGTGGG + Intronic
938405678 2:131031929-131031951 GCCCACACGGTGGTGGTGGTGGG - Intronic
939805209 2:146767358-146767380 ATTCACATCCTGGGGGGGGTGGG - Intergenic
940425386 2:153525648-153525670 TTTCACATACTGGTGGGGGTGGG - Intergenic
943218327 2:185069226-185069248 TCTCACATGCTTGTTGTGTTGGG - Intergenic
943746554 2:191468253-191468275 AGTGAGATGGTGGTGGTGGTAGG + Intergenic
946015824 2:216603155-216603177 CCACAGATGCTGGTGGTGCTGGG - Intergenic
946574862 2:221063974-221063996 ATTCATAGGGTGGTGGTGGTGGG - Intergenic
947327763 2:228996572-228996594 ACGCACATGCTGGCAGTGGGAGG + Intronic
947889879 2:233608039-233608061 TCTCATATGCTTGTGGTGGGAGG - Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
1169974142 20:11304515-11304537 ACTAACATGCAAGTAGTGGTTGG - Intergenic
1170055893 20:12202030-12202052 AGACACATGCTGGTGGTTGGGGG + Intergenic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1170503274 20:16996991-16997013 TTTCACATGCTGGTGCTGGAAGG - Intergenic
1172180930 20:33003029-33003051 AATCACAGGCTGGTGGTGTTGGG - Intronic
1172450196 20:35016931-35016953 ATTCACACGCTGTTGGTGGGAGG + Intronic
1173454455 20:43191254-43191276 ACGGTCATGGTGGTGGTGGTGGG - Intergenic
1175222269 20:57424120-57424142 GCTCACCTGCTGTTGCTGGTGGG - Intergenic
1175661371 20:60815910-60815932 CCTCAAATGAAGGTGGTGGTGGG - Intergenic
1176268990 20:64225665-64225687 ACTCAGAAGCAGGTGGTGGGAGG + Intronic
1178705768 21:34871621-34871643 ACTGACATGCTGGGGCAGGTGGG + Intronic
1179312736 21:40210946-40210968 CCTCATTTGATGGTGGTGGTGGG - Intronic
1180194521 21:46184713-46184735 ACTGGGATGGTGGTGGTGGTGGG - Intergenic
1180564216 22:16649350-16649372 ACTCATCTGTTGGTGGTGGGTGG + Intergenic
1180614824 22:17120409-17120431 ACTGACCTGGTGGTGGTGGTGGG - Exonic
1181076269 22:20379393-20379415 TCACACATACTGGTGGTGGAGGG - Intronic
1181262189 22:21606528-21606550 AATTAAATGGTGGTGGTGGTGGG - Intronic
1182378651 22:29868364-29868386 TCTCAGAGGCTGGTGGGGGTGGG + Intergenic
1182657537 22:31902698-31902720 AGCCAGATGCTGGTGGAGGTGGG - Intronic
1184708847 22:46235570-46235592 ACTCAAATGCTGGGGGTAGGTGG + Exonic
949097796 3:106661-106683 ACTCACATGCTGCTGGTTGCTGG - Intergenic
951768610 3:26229119-26229141 ATTCACATTATGGTGGTAGTTGG - Intergenic
953789293 3:45934973-45934995 ACTCACAAGCTGTTGATGCTGGG - Intronic
954294824 3:49668461-49668483 AGTCACAAGGTGGTGGTGGAGGG - Exonic
954453237 3:50582967-50582989 TGACATATGCTGGTGGTGGTGGG - Exonic
954905175 3:54055793-54055815 GTCCACATGGTGGTGGTGGTAGG - Intergenic
956443665 3:69304792-69304814 AAGAACATGCTGATGGTGGTGGG + Intronic
957723273 3:84031934-84031956 GGTCAGATGCTGGTGGAGGTGGG - Intergenic
962268814 3:133963111-133963133 ACTCACATGCTGGTGGGGTGGGG - Intronic
962615806 3:137125357-137125379 AAGCCCATGCTTGTGGTGGTTGG + Intergenic
962742605 3:138372920-138372942 ACATACAAGCTGGTGGTGGTGGG + Exonic
964326912 3:155556814-155556836 ACTCTCATGCTTGTGGGTGTTGG - Intronic
965901336 3:173644964-173644986 GCTCAGAGGCTGGTGGTGGGAGG + Intronic
966335843 3:178867208-178867230 ACTTACATGATTGTGGGGGTTGG - Intergenic
966451446 3:180067424-180067446 ATTCATATGCTGGGGGAGGTGGG - Intergenic
967931112 3:194690906-194690928 ACTGACAGGCATGTGGTGGTTGG + Intergenic
968187988 3:196646424-196646446 CCTTGCATGCTGGTGGTGGCTGG - Intronic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
969081307 4:4620710-4620732 CCACACATGGTGGTGGTGTTTGG + Intergenic
969718805 4:8881792-8881814 ATTTCCATGGTGGTGGTGGTGGG + Intergenic
973612293 4:52647643-52647665 AGACACATGCTGGTGGTGTGTGG - Intronic
974293705 4:59967419-59967441 ACTTAGATTCTGGTGGGGGTAGG - Intergenic
975487805 4:74953776-74953798 TCTCAGATGTCGGTGGTGGTGGG - Intronic
975762562 4:77633492-77633514 ACCCACATGGTGTTGGTGCTGGG + Intergenic
976702360 4:87985181-87985203 ACTCACCTGCAGGTGATGGCTGG + Intergenic
978165658 4:105603518-105603540 ATTCCCATGATGGTGGTGTTGGG + Intronic
979101632 4:116624070-116624092 TATCACATGCTGGTGAAGGTGGG - Intergenic
980087731 4:128409303-128409325 TCTCAAATGCTGGTTGTGCTAGG + Intergenic
980532200 4:134070578-134070600 ACTCACATGCCGCTGGAGGAGGG + Intergenic
983442052 4:167798761-167798783 ACTATCATTCTGGTGGAGGTGGG - Intergenic
984278537 4:177639077-177639099 ACTCACCAGCTGGAGGTGGGTGG + Intergenic
985644668 5:1079294-1079316 AGTCACATGCTGGTGGCCGAGGG + Intronic
986495569 5:8338492-8338514 TTTCACAAGGTGGTGGTGGTGGG - Intergenic
986860501 5:11921471-11921493 ACTAATACGCTGGTGGTGGAGGG + Intergenic
987089579 5:14498939-14498961 ACTCAGAAGCTGGTCGTGGGGGG - Intronic
989811473 5:45681948-45681970 ACCCACATGATAGTGGTGTTGGG + Intronic
992626385 5:78639161-78639183 ACCCCAATGGTGGTGGTGGTGGG - Intronic
992844650 5:80734364-80734386 AATTACATGGTGGTGATGGTTGG + Intronic
993208716 5:84920831-84920853 ACCCAAATGCTGATGGTGATAGG + Intergenic
993812673 5:92501837-92501859 AGGCATATGCTGATGGTGGTTGG + Intergenic
995022455 5:107381736-107381758 AGTGACATGTTGGTGGGGGTGGG + Intronic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
999663978 5:153893887-153893909 ACTCTCATGCTGTTTGTGCTGGG - Intergenic
1000730106 5:164824319-164824341 ACTCACAATCTGCTAGTGGTTGG + Intergenic
1001162848 5:169336623-169336645 ACACACATGGTGGTGGGGGTAGG + Intergenic
1004094743 6:12541782-12541804 CCTCAGATGCCGCTGGTGGTAGG - Intergenic
1004300499 6:14453279-14453301 AATGGCATGCTGGTGGTGGCAGG - Intergenic
1007886445 6:45235827-45235849 ACTCCCATGCTGAAGGTTGTGGG + Intronic
1008198634 6:48558377-48558399 CCTCACATGATTGTGGAGGTTGG + Intergenic
1008557468 6:52688111-52688133 AGCCACATTCTGGTGGAGGTGGG + Intergenic
1011091529 6:83607262-83607284 ACTCACACTCTGGTGGTAGGAGG - Intronic
1012279716 6:97314414-97314436 ATTCAGTTCCTGGTGGTGGTGGG + Intergenic
1013715074 6:112950429-112950451 ACTTACATGTGGGAGGTGGTAGG - Intergenic
1013847768 6:114475078-114475100 ACTCATATACTGCTGGTGGCAGG + Intergenic
1015563069 6:134537297-134537319 ATTCACATGCCGATGGTGCTGGG - Intergenic
1016425869 6:143935124-143935146 CTGCAGATGCTGGTGGTGGTGGG + Intronic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1017556431 6:155576136-155576158 ACTTCCGGGCTGGTGGTGGTTGG + Intergenic
1018636567 6:165865061-165865083 GCACAAATGGTGGTGGTGGTAGG - Intronic
1019219892 6:170464855-170464877 TCACACCTGCTGGTGGTGGAGGG + Intergenic
1020736364 7:11953868-11953890 ACTCACATTCTGGAGGCGATGGG + Intergenic
1021497082 7:21287666-21287688 ACTCAAAAGCTGGACGTGGTGGG + Intergenic
1023700703 7:42889132-42889154 CCTGACATGCTCCTGGTGGTAGG - Intergenic
1023893034 7:44407163-44407185 ACTCAGCTGTCGGTGGTGGTGGG + Intronic
1024672513 7:51608875-51608897 GCTCACAGGCTGGTAGAGGTTGG + Intergenic
1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG + Intronic
1028636608 7:92996586-92996608 ACTCACATGTTTGTGGTGATGGG - Intergenic
1030711571 7:112756337-112756359 AGTCACAAGTTGGTGGTGGTAGG + Intergenic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1031098071 7:117444562-117444584 AGACACTTGGTGGTGGTGGTTGG - Intergenic
1031351425 7:120736350-120736372 ACTGACATGCTGGTGGGTATAGG + Intronic
1034001853 7:147423084-147423106 ACTTAGAGCCTGGTGGTGGTCGG - Intronic
1034136784 7:148778347-148778369 ACGCACAGACTGGTAGTGGTGGG + Intronic
1036150199 8:6289924-6289946 ACACACAGGAGGGTGGTGGTGGG - Intergenic
1036195057 8:6707286-6707308 GCTCCCATTATGGTGGTGGTGGG + Intergenic
1036894954 8:12626350-12626372 AGTCATTTGCTGGTGGTAGTGGG - Intergenic
1036924807 8:12893976-12893998 ACTCCCATTGTGGTGGTGGTGGG - Intergenic
1038096911 8:24323279-24323301 ACTCCCAAGGTGGTGGTGTTAGG - Intronic
1038444012 8:27590738-27590760 TCCCACAGGCTGGAGGTGGTGGG + Intergenic
1041156447 8:54992147-54992169 CCTCACATGGTGGTTGGGGTGGG + Intergenic
1041904197 8:63013491-63013513 TCTTTCCTGCTGGTGGTGGTGGG + Intergenic
1042723983 8:71852490-71852512 CCTCACATGCTCGTGATGATTGG + Intronic
1044852000 8:96437720-96437742 ACTCACAGGCTCCTGGTGGGTGG + Intergenic
1046576231 8:116033324-116033346 ACTCACATGCTAGTGGAGTAAGG + Intergenic
1047409283 8:124611107-124611129 AGTCACATGCTGGGGGGGGGGGG - Intronic
1047619950 8:126596218-126596240 ACTCACATGGTGCTGGTTTTTGG + Intergenic
1049596430 8:143485971-143485993 GCTCACATGCTGCTGCTGGCAGG + Intronic
1049897361 9:120483-120505 CCTCACATGCTGGGGGCGCTGGG - Intergenic
1051156656 9:14155425-14155447 ACTAACATTTTGGTGGGGGTTGG - Intronic
1053424074 9:37999663-37999685 TCCCACGTGCTGCTGGTGGTTGG - Intronic
1055017659 9:71635828-71635850 ACTCCCAGGCTGGTGGGGGTGGG + Intergenic
1055029024 9:71753264-71753286 ACTAACAGGCTGGTGGGGGCGGG + Intronic
1057939999 9:99273590-99273612 AGGAACATGCTGGTGGTGGGTGG - Intergenic
1060656750 9:125377154-125377176 ACTTTCCTGCTGGTGGTTGTGGG + Intergenic
1061451626 9:130670101-130670123 ACCCACAGGCTGCTGGGGGTAGG + Intronic
1186308224 X:8288454-8288476 ACTCAGAAGATGGTGGTTGTTGG - Intergenic
1186963671 X:14764215-14764237 GCTCACATGGTTGTGGTTGTTGG + Intergenic
1187436248 X:19272559-19272581 ACTCTCATGCTGCTGCTGGTGGG + Intergenic
1188197232 X:27251552-27251574 ACTCTCCTCCTGGTGGTGGCAGG - Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1188367099 X:29330083-29330105 AATTACATGGTAGTGGTGGTTGG + Intronic
1188493056 X:30756165-30756187 ACACACATGCTGGTGGGGCAGGG - Intergenic
1188970896 X:36613756-36613778 ATTCACATGCTTGTGGCAGTAGG - Intergenic
1189552511 X:42107816-42107838 ACTTACATTCTGGTGTTGGGAGG + Intergenic
1189805657 X:44733141-44733163 AATCACTTGCTTTTGGTGGTGGG + Intergenic
1192434885 X:71137013-71137035 ACTCACCTGCAGGTAGTGGCTGG - Exonic
1193682378 X:84538579-84538601 ACAGACATGCTGCTGGTGGTGGG - Intergenic
1193826190 X:86230310-86230332 ACTCACTTGATCATGGTGGTTGG + Intronic
1194261315 X:91699547-91699569 ACACACATGCTGGTGGGGAAAGG + Intergenic
1195707090 X:107745097-107745119 ACTCACATGCTGGCTTTGGGTGG - Intronic
1196408113 X:115387032-115387054 ACTCACATTCTGGTGATGACAGG + Intergenic
1196716945 X:118821490-118821512 ACTGGAATGGTGGTGGTGGTGGG - Intergenic
1197840813 X:130744203-130744225 ATTGGGATGCTGGTGGTGGTAGG + Intronic
1197891890 X:131277126-131277148 GCTCATATGCTGGTGGGGGGTGG + Exonic
1200579966 Y:4938348-4938370 ACACACATGCTGGTGGGGAAAGG + Intergenic