ID: 915762968

View in Genome Browser
Species Human (GRCh38)
Location 1:158333884-158333906
Sequence GAGGTTAAACAGACAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 2, 2: 19, 3: 69, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915762963_915762968 17 Left 915762963 1:158333844-158333866 CCTTGCCTACAAATATCAATAAC 0: 1
1: 5
2: 53
3: 118
4: 362
Right 915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG 0: 1
1: 2
2: 19
3: 69
4: 288
915762964_915762968 12 Left 915762964 1:158333849-158333871 CCTACAAATATCAATAACAACGG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG 0: 1
1: 2
2: 19
3: 69
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915762968 Original CRISPR GAGGTTAAACAGACAGTTGC TGG Intergenic
901037217 1:6343561-6343583 GGGGTGAAAGAGACAGTTCCAGG - Intronic
902090760 1:13901377-13901399 AAGGTTAAAAAGACAGTCACGGG + Intergenic
902373381 1:16018711-16018733 GAGATGGAGCAGACAGTTGCCGG - Exonic
903182352 1:21611382-21611404 GAGGCTGAACAGACAGGTGGAGG + Intronic
904317034 1:29672283-29672305 GAGGGAAAACAGACACTTGAGGG - Intergenic
904344861 1:29861115-29861137 GAGGATACACTGACAGTTGAAGG + Intergenic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
905721640 1:40208242-40208264 GAGATGAAACAGCCAGTTGGTGG + Intronic
905927483 1:41762281-41762303 GAGATTACACTGACAGTTGAAGG - Intronic
906911072 1:49951484-49951506 AAGGTTGGACAGGCAGTTGCTGG - Intronic
907668279 1:56452071-56452093 GAGGTTAAGCCAACAGATGCTGG - Intergenic
907673521 1:56497937-56497959 AAGGTGAAACAGACATTTACTGG + Intronic
907889345 1:58622681-58622703 GAGGTTGAAAAGAGAGCTGCAGG + Intergenic
908367369 1:63439626-63439648 GAGGTCAAACATACAGTAACTGG + Intergenic
909621358 1:77671066-77671088 GAGGTTGGACCGGCAGTTGCTGG - Intronic
910238979 1:85065522-85065544 GAGGTTGGACAGGCAGTTCCTGG + Intronic
910417344 1:87014760-87014782 AAGGTTGGACAGCCAGTTGCTGG - Intronic
910427441 1:87131359-87131381 GAGGTCAAACAGACAACTGGGGG + Intronic
910474654 1:87593909-87593931 TAGATTTAACAGACAGTTGAGGG - Intergenic
910717010 1:90243362-90243384 AAGGTTGAATAGGCAGTTGCTGG + Intergenic
910839976 1:91551965-91551987 GAGATTCAACAGACAGTAACTGG + Intergenic
912206655 1:107516328-107516350 GAGGTTAAACAGATAGATAGGGG + Intergenic
912541377 1:110418675-110418697 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
913163112 1:116163206-116163228 GAGGTGAAAAAGACAGTGGAGGG + Intergenic
913329298 1:117653942-117653964 AAGGTCACACAGCCAGTTGCTGG - Intergenic
915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG + Intergenic
916090023 1:161300595-161300617 GAGGTTTGACAGACAGTTGTTGG + Intergenic
916693125 1:167210134-167210156 GAGGTTAAACAGTCAGTGAGAGG + Intergenic
917072667 1:171169311-171169333 GAGGTTACACTGACAATTGAAGG - Intergenic
918935966 1:190922847-190922869 GAGATTAAACAGACAGGTGAGGG - Intergenic
920612907 1:207459155-207459177 GAGGTTATACAGGCAGATGCCGG + Intronic
921460727 1:215423478-215423500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
922938652 1:229440981-229441003 GAGGTTGGACAGGGAGTTGCTGG - Intergenic
923047902 1:230368902-230368924 GAGGTTCAACACACAGTCTCAGG + Intronic
923069873 1:230553059-230553081 GAGGTTGGACAGGCAGTAGCTGG + Intergenic
924323975 1:242876934-242876956 GAGGTTAGACAGGCAGTTGCTGG + Intergenic
924496492 1:244595468-244595490 CAAGTAAAACAGACAGTTGGAGG + Intronic
924938493 1:248792446-248792468 GAGGTTGGACAAGCAGTTGCTGG + Intergenic
1062823897 10:554881-554903 GAGGATAGACAGACACTTGGAGG + Intronic
1063141806 10:3262497-3262519 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1063692584 10:8301156-8301178 ATGCTTAAACAGACAGTTTCAGG + Intergenic
1064571800 10:16701468-16701490 AAGGCCAAGCAGACAGTTGCCGG - Intronic
1065848694 10:29768226-29768248 GAGGTCGGACAGGCAGTTGCTGG - Intergenic
1069061420 10:63898494-63898516 AAGGTTAAACAGCCAGTGACTGG - Intergenic
1071692986 10:87842354-87842376 GAGGTTAAAAGTACAGTTTCTGG - Intergenic
1073728813 10:106267473-106267495 GAGGTTGCACAGACACTTGAAGG - Intergenic
1074378542 10:112959433-112959455 GAGGGTAAATAGACATTTGATGG + Intronic
1075173703 10:120139990-120140012 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1075410401 10:122223612-122223634 GAGGTTATTCAGCCATTTGCAGG + Intronic
1077338349 11:2015323-2015345 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1078473897 11:11613949-11613971 GATGTTACACAGAAAGTTCCTGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079424303 11:20325688-20325710 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1079674080 11:23202991-23203013 GAGGTTACACAGACAACTGGAGG - Intergenic
1080196560 11:29616749-29616771 AAGTTTGAACAGGCAGTTGCTGG + Intergenic
1080761870 11:35258608-35258630 TAGGTTAAGGAGACAGTTCCTGG - Exonic
1081440981 11:43080656-43080678 GAGGTTGGACAAACAGTTGCTGG + Intergenic
1082683452 11:56208512-56208534 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1083985121 11:66209374-66209396 GAGGTTAAAGAGGAAGTTCCTGG + Intronic
1084976130 11:72799637-72799659 GGGGTTAGCCAGGCAGTTGCTGG + Intergenic
1085633993 11:78143893-78143915 GAGGTTAAATAGACAGGACCTGG - Intergenic
1086850176 11:91799275-91799297 GAGGTTAAGCAGACAACTGGAGG - Intergenic
1086971034 11:93081159-93081181 AAGGTCAAACAGGCAGTTGCTGG - Intergenic
1088185028 11:107157611-107157633 AAAGTTGAACAGGCAGTTGCTGG - Intergenic
1090720247 11:129466249-129466271 AAGCTTGAACAGGCAGTTGCTGG - Intergenic
1202821333 11_KI270721v1_random:70505-70527 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1093065012 12:14648508-14648530 GAGGTTGGACAGGCAGTTGTTGG - Intronic
1093323229 12:17739910-17739932 GAGGTTCAACTCACTGTTGCTGG - Intergenic
1094799728 12:34019179-34019201 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095112517 12:38313498-38313520 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1096048154 12:48582475-48582497 AAGGCTGAACAGACAGTTGCTGG + Intergenic
1096200759 12:49680854-49680876 AAGGTTACACAGAAAGTAGCAGG + Intronic
1096401652 12:51312296-51312318 AAGGTTGAACAGGCAGTTGCTGG - Intronic
1098786346 12:74761570-74761592 GAGGTTAGACAGGCAGTTGCTGG - Intergenic
1098859534 12:75692116-75692138 GAGGTGAGACAGACAGGTGTGGG + Intergenic
1099310360 12:81012851-81012873 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1099795101 12:87390310-87390332 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1101503437 12:105325607-105325629 CAGGTTCGACAGGCAGTTGCTGG + Intronic
1102182160 12:110920764-110920786 AAGGTTAAAGAGGCAGTAGCTGG + Intergenic
1102694099 12:114784722-114784744 GAAGTTGGACAGGCAGTTGCTGG - Intergenic
1104839145 12:131812574-131812596 AAGGTTAGACAGGCAATTGCTGG - Intergenic
1104840339 12:131821480-131821502 GGGGTTGGACAGGCAGTTGCTGG - Intergenic
1105970249 13:25422837-25422859 GAGGTTGCACAGGCTGTTGCTGG + Intronic
1106758217 13:32843362-32843384 GAGGTTGCACAGGCGGTTGCTGG + Intergenic
1107356342 13:39571563-39571585 GAGGTCACACAGATAGTTGAAGG - Intronic
1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG + Intronic
1108489648 13:50968494-50968516 GAGGTCATACAGACAGTAGGTGG + Intronic
1111028923 13:82570370-82570392 GAGGTTACACTGACAATTGAAGG + Intergenic
1112673203 13:101665907-101665929 AAGGTTAGGCAGGCAGTTGCTGG - Intronic
1112812197 13:103231798-103231820 AAGGTTGAAAAGGCAGTTGCTGG - Intergenic
1113196080 13:107808123-107808145 AAGGTTGGACAGGCAGTTGCGGG + Intronic
1113214205 13:108018969-108018991 AAGGTTTGATAGACAGTTGCTGG - Intergenic
1113481144 13:110622391-110622413 GTGTTTAAAAAGTCAGTTGCTGG + Intronic
1114446984 14:22796203-22796225 GAGGTGGAACAGTCAGATGCTGG - Intronic
1114657977 14:24327469-24327491 GAGGTTCAGCTGACTGTTGCAGG - Intronic
1114792606 14:25676693-25676715 GAGGTCATACAGCCAGCTGCGGG - Intergenic
1114939224 14:27586299-27586321 GAGGTTAAACATTCATTTGCTGG + Intergenic
1115549676 14:34493850-34493872 AAGGTTGAACAGGCAGTTGCTGG + Intergenic
1117122605 14:52584421-52584443 AAGGCTGAACAGGCAGTTGCTGG + Intronic
1118886576 14:69872049-69872071 AAGGTTAAACAGACAGTTACTGG - Intronic
1120753833 14:88223194-88223216 AAGGTTGGACAGTCAGTTGCTGG - Intronic
1120771411 14:88384417-88384439 AAGGTTGGACAGACAATTGCTGG + Intergenic
1121165245 14:91790037-91790059 GAGGTTATACAGCCAGTAGTTGG - Intronic
1121802178 14:96783904-96783926 GAGGTTAGACAGGCAATTGCTGG + Intergenic
1122668034 14:103347564-103347586 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
1123104721 14:105835440-105835462 GAGGTTGGACAGCCCGTTGCTGG + Intergenic
1123175084 14:106409344-106409366 AAGGTTGAATAGGCAGTTGCGGG + Intergenic
1123185972 14:106517347-106517369 AGGGTTAAACAGGGAGTTGCTGG + Intergenic
1123185983 14:106517422-106517444 AGGGTTAAACAGGGAGTTGCTGG + Intergenic
1123201868 14:106673871-106673893 AAGGTTGAACAGGCAGTTGCAGG + Intergenic
1202943602 14_KI270726v1_random:6433-6455 AAGGTTGAACAGGCAGTTGCAGG - Intergenic
1123990725 15:25681304-25681326 GAGGTTGGACAGACAGTTGCTGG - Intronic
1125751145 15:42029914-42029936 AAGGTTACACAGATAGTTTCAGG + Intronic
1126193536 15:45904669-45904691 GCGGTTGGACAGGCAGTTGCTGG + Intergenic
1126570970 15:50150187-50150209 GAGCTTGAACAGTGAGTTGCTGG + Intronic
1126840576 15:52713973-52713995 GAGGTAAAAAAGACAGTGGCTGG - Intergenic
1126855944 15:52839528-52839550 GAGGTCACACAGACAGTTGTGGG + Intergenic
1127045023 15:55016676-55016698 GAGGTTAGACAGTCATTTGGAGG - Intergenic
1127847649 15:62885436-62885458 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1128742207 15:70091695-70091717 GAGGTTAAACTCACTGTGGCTGG - Intronic
1129299912 15:74619599-74619621 GAGGTTAAGCGGAAAGATGCTGG - Intronic
1132177474 15:99726929-99726951 GAGGTTACTCAGACAGGTGCAGG - Intronic
1134507018 16:14816114-14816136 GAGGTTAAACAGACTGTTGTTGG + Intronic
1134530082 16:14975774-14975796 GCGGTTAAACACGCAGTTCCCGG - Intronic
1134573541 16:15312712-15312734 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1134728881 16:16443603-16443625 GAGGTTAAACAGACTGTTGTTGG + Intergenic
1134938563 16:18268321-18268343 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1135067882 16:19326114-19326136 GAGGTAAAAGAATCAGTTGCTGG + Intergenic
1135152014 16:20016367-20016389 GAGATTCGACAGACAGTTGCTGG + Intergenic
1135663898 16:24319373-24319395 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1135976695 16:27113197-27113219 GAGGTGAAACTGACAGGTGGTGG - Intergenic
1136048849 16:27636490-27636512 GAGGTTACACAGCCAGCTCCAGG - Intronic
1136048855 16:27636551-27636573 GAGGTTACACAGCCAGCTCCAGG - Intronic
1136048859 16:27636588-27636610 GAGGTTACACAGAGAGCTCCAGG - Intronic
1138791723 16:59912303-59912325 GAGGTTGAACAGACAGCTGCTGG + Intergenic
1142923284 17:3209970-3209992 GATGATAAAAAGCCAGTTGCTGG - Intergenic
1144431544 17:15196774-15196796 GAGGTTGGACAGAGAGCTGCTGG - Intergenic
1144583223 17:16471884-16471906 GAGGGTAAAATGGCAGTTGCTGG + Intronic
1145101963 17:20085008-20085030 GAGGTTTACCAGACAGTAGAGGG + Intronic
1149257236 17:54840506-54840528 CAGGTAAAAGAAACAGTTGCAGG + Intergenic
1150953436 17:69827651-69827673 GAGGTTAGGGAGGCAGTTGCTGG + Intergenic
1151018483 17:70584734-70584756 GAGGTCACACAGACGGTTGAAGG + Intergenic
1151798153 17:76360537-76360559 CAGGTTGTACAGGCAGTTGCTGG + Intronic
1152432229 17:80254884-80254906 GAAGGTAAACAGACTGTGGCGGG + Intergenic
1155130759 18:22932839-22932861 GAGGTTAAACGGGAAGTTTCTGG - Intronic
1156954821 18:42949491-42949513 GTGGTTAGACAGGCAATTGCTGG + Intronic
1157782844 18:50455457-50455479 GATGTTGAACAGGCAGTTGCAGG - Intergenic
1157848580 18:51027049-51027071 AAGGTTGAAAACACAGTTGCCGG + Intronic
1158712589 18:59850387-59850409 GATGTTAAACTCACAATTGCTGG + Intergenic
1159061729 18:63521059-63521081 AATGTTAAACAGGCAGTTGGTGG + Intergenic
1159891408 18:73956430-73956452 CAGGTTAAAGAGACAATGGCAGG - Intergenic
1161303859 19:3556470-3556492 GCAGTTAAACAGACAGATGGGGG + Intronic
1161866775 19:6838645-6838667 GATGATAAACAGACAGGTGATGG - Intronic
1164553586 19:29232791-29232813 GAGGTGACACAGACAGTGCCTGG + Intergenic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1166259917 19:41631025-41631047 GAGGTTCTATAGGCAGTTGCTGG + Intronic
1166515275 19:43441928-43441950 GGGGTTGGACAGGCAGTTGCTGG + Intergenic
1166610454 19:44188975-44188997 AAGGTTGGACAGCCAGTTGCTGG + Intergenic
1166610935 19:44195621-44195643 AAGGTTGGACAGCCAGTTGCTGG + Intergenic
1166912371 19:46168309-46168331 GAGTTTGGACAGGCAGTTGCTGG + Intergenic
1167226867 19:48250324-48250346 GAGGTTGGACAGGCAGTTGCTGG + Intronic
927136783 2:20102802-20102824 GAGGTTCGACAGGCAGTTGATGG + Intergenic
927298193 2:21479308-21479330 GAGGTTGGAGAGGCAGTTGCTGG + Intergenic
927300465 2:21506321-21506343 GAGTTTAGACAGGCAGTGGCTGG - Intergenic
927578711 2:24222479-24222501 GAGGTTGGACAGGCAGTTGCTGG - Intronic
928818475 2:35329126-35329148 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
930225253 2:48785520-48785542 GAGGTTAAATAGAAAATGGCAGG - Intergenic
930512236 2:52359460-52359482 GAGGATACACTGACAGTTGAAGG + Intergenic
930520734 2:52463647-52463669 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
930899231 2:56483316-56483338 GAGGTTGGACAGGCAGTTACTGG - Intergenic
932102615 2:68914463-68914485 GAGTTTATACACACAGATGCTGG + Intergenic
932719798 2:74130766-74130788 GAGGATTAACAAACAATTGCCGG + Exonic
933126007 2:78606996-78607018 GAGCTTAAACAGGCACTTGCAGG + Intergenic
933245838 2:79973814-79973836 AAGGTTGGACAGGCAGTTGCTGG + Intronic
933376147 2:81482020-81482042 GGGGTTACACAGACAGCTGGAGG + Intergenic
934103422 2:88674694-88674716 GAGGTGGGACAGACAGTTGCTGG + Intergenic
935141690 2:100358811-100358833 GGGGTTGGACAGGCAGTTGCTGG - Intergenic
935897680 2:107755324-107755346 GAGGTTAAAGAAACAGTGGAAGG - Intergenic
936473609 2:112820537-112820559 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
936608660 2:113980480-113980502 AAGGTTAGACAGGCAGTTGCTGG + Intergenic
936618578 2:114072749-114072771 GACATCAAACAGGCAGTTGCTGG - Intergenic
938790907 2:134674836-134674858 GAGGTTGGATAGGCAGTTGCTGG - Intronic
939466431 2:142562437-142562459 GAGGTTACACAGACAACTGGAGG - Intergenic
941033266 2:160537176-160537198 AAGTTTAAATAGGCAGTTGCTGG + Intergenic
941190647 2:162377555-162377577 GAGATTGGACAGGCAGTTGCTGG + Intronic
941345421 2:164362456-164362478 GAGGTTAAGCAGAATGTTGAAGG - Intergenic
941747733 2:169104819-169104841 GAGGTTGGGCAGACAGTTCCTGG + Intergenic
944178230 2:196857791-196857813 GAGGTTGAGCAGGCAGTTGCTGG - Intronic
944795923 2:203185098-203185120 AAGGTTGAACAGGCAGTTGCTGG + Intronic
945287875 2:208100258-208100280 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
945390283 2:209257458-209257480 GTGGTTAGACAGGCAATTGCTGG - Intergenic
945673464 2:212830040-212830062 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947718534 2:232353694-232353716 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1169325870 20:4676035-4676057 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1170628186 20:18045347-18045369 GACTTTCAAAAGACAGTTGCAGG - Intronic
1170700428 20:18698697-18698719 GAGGGTAAGGAGACAGATGCAGG - Intronic
1171320281 20:24237138-24237160 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1172752261 20:37259098-37259120 GAGGCTTAACAAACATTTGCAGG - Intronic
1172763888 20:37340650-37340672 AAGGTCACACAGAGAGTTGCTGG - Intergenic
1174349858 20:49959262-49959284 GAGGTTGTACAGGCAGTTGCTGG - Intergenic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1177546148 21:22561674-22561696 GAGGTTACACTGACAGCTGAAGG - Intergenic
1177641294 21:23847386-23847408 AAGGTTGAACAGGCAGTTACTGG - Intergenic
1177962083 21:27679886-27679908 GAGGTCACACAGACACTTGAAGG + Intergenic
1178540018 21:33441518-33441540 AAGGTTAGACAGGCAGTTGTTGG + Intronic
1180210019 21:46289843-46289865 AAGGTTAGACAGGCAGTTGCTGG + Intronic
1180990677 22:19933889-19933911 GAGGCAAGACAGACACTTGCTGG - Intronic
1183183350 22:36276893-36276915 AAGGTTAAACAGACAGTTGTTGG - Intergenic
1183942993 22:41306856-41306878 GAGGTTATTCAGACAGCAGCGGG + Intronic
1184018265 22:41801988-41802010 GAGGTTGGACAGGCAGTTGCAGG + Intronic
1184957839 22:47903766-47903788 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
949549753 3:5103086-5103108 GAGGTTGGACAGGCAGTTACTGG + Intergenic
951615908 3:24543722-24543744 GAGGTTGGACAGGCAGTTACTGG + Intergenic
951637360 3:24794295-24794317 GAGGTTAAACAGAAACTAGCTGG + Intergenic
952591238 3:34956634-34956656 AAGGTTGAACAGGCAGTTGCTGG + Intergenic
952891641 3:38046179-38046201 GAGATTAAACAGGCGGTTGCTGG + Intronic
953052273 3:39355543-39355565 GAGGTTAAACTGGCAGTTGCTGG + Intergenic
953146923 3:40286154-40286176 GAGGTTGGAGAGGCAGTTGCTGG - Intergenic
953363288 3:42319891-42319913 AAGATTAGACAGGCAGTTGCTGG + Intergenic
954639080 3:52087391-52087413 GTGGTTAAAAAGACAGTTGCTGG - Intronic
954965731 3:54609037-54609059 GGGCTTAAACACACAGTTGTTGG - Intronic
955545901 3:60029835-60029857 GAGGTTGGACAGGCAGTTGTTGG + Intronic
955844205 3:63143804-63143826 GAGGTTGAACAGGCGGTTGCTGG - Intergenic
956478645 3:69650771-69650793 GATGTTGGACAGGCAGTTGCTGG - Intergenic
956847399 3:73196069-73196091 GAGGTTAAAGAAACAGGTGGGGG - Intergenic
958982121 3:100734006-100734028 GAGGTTGGACAGGCAGTTTCTGG + Intronic
960585135 3:119314197-119314219 GAGGCTAAAAAGAGAGTTGAGGG - Intronic
961237243 3:125377527-125377549 GAGGTTGGACAGGCATTTGCTGG + Intergenic
961400807 3:126641036-126641058 GAGGCTGGACAGGCAGTTGCTGG - Intronic
962043131 3:131728392-131728414 GAGGTTAAACACACAGGTTCTGG - Intronic
962146689 3:132847056-132847078 AAGGTTAGACAGGCAGTTGCTGG - Intergenic
963024626 3:140906918-140906940 CAGGTTGGACAGGCAGTTGCTGG + Intergenic
963284913 3:143424780-143424802 GTGGTTAAAAACACAGGTGCTGG + Intronic
963538559 3:146559061-146559083 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
964871394 3:161317189-161317211 AAGGTTAAACAGGCAGTTGCTGG - Intergenic
965169952 3:165250240-165250262 GAGGTTAGAGAAGCAGTTGCTGG + Intergenic
966093464 3:176169578-176169600 GATGTTAAACAAAGAGTTCCTGG + Intergenic
966502020 3:180653287-180653309 AAGGTTGATCAGTCAGTTGCTGG - Intronic
966685765 3:182692852-182692874 GAGGTTGAACAGGAAGTTGCTGG + Intergenic
967017768 3:185497205-185497227 GACGTAAAACAGAAAGTAGCAGG - Intronic
967219105 3:187234490-187234512 AAGGTTATACAGCCAGTTGGGGG + Exonic
968887894 4:3345169-3345191 AAGGTTGGACAGGCAGTTGCGGG + Intronic
970276537 4:14406946-14406968 GTGGGTAAACAGACAGCTCCTGG + Intergenic
970797004 4:19924638-19924660 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
971109828 4:23572704-23572726 GAGGTTATGCTGACAGTTGAAGG + Intergenic
972239263 4:37172417-37172439 GAGGTTAGACAGGCAGTCGCTGG - Intergenic
972857511 4:43124691-43124713 GAGGTTAAAAAAACAGTTAAAGG + Intergenic
973786258 4:54335419-54335441 GAGGTAAAGCAGACAGTATCTGG - Intergenic
974715692 4:65668141-65668163 GAGGTTAAAGAGAAAGTTCATGG + Intronic
976175070 4:82343551-82343573 GAGGTTAAACAAACATTTTGAGG - Intergenic
976196665 4:82538757-82538779 GATGTTAAAAAGACATTTGAGGG + Intronic
976857424 4:89621517-89621539 GAGATTGGACAGGCAGTTGCTGG + Intergenic
977541825 4:98327391-98327413 GAGGTTGGACAGACAGTTGCTGG + Intronic
980418507 4:132526001-132526023 GAGGTTATAGAGGCAATTGCTGG + Intergenic
980729142 4:136804730-136804752 GAGATTATGCAGACAGTTGACGG - Intergenic
983333302 4:166359316-166359338 GAGGTTACACTGACAATTGCAGG + Intergenic
983857737 4:172666543-172666565 AAGGTTGAACAAGCAGTTGCTGG - Intronic
984011892 4:174381445-174381467 AAGGTTAAACAGAAAGTTGCTGG + Intergenic
985697689 5:1350340-1350362 GAGGTTGGACAGGCAATTGCTGG - Intergenic
986213112 5:5692644-5692666 GAGGTTGGACAGGCAGTTGTTGG - Intergenic
986341385 5:6792211-6792233 GAGGTTGGACAGGCAGCTGCTGG + Intergenic
986518939 5:8593478-8593500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
988226760 5:28423145-28423167 GAAGTTAGACAGGTAGTTGCTGG + Intergenic
988641031 5:33041048-33041070 GAGGTTACACAGACAACTGGAGG + Intergenic
988829474 5:34973505-34973527 AAGATAAAACATACAGTTGCAGG + Intergenic
989043778 5:37254366-37254388 GAAGTTGAACGGGCAGTTGCTGG - Intergenic
992293807 5:75306917-75306939 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
992701988 5:79350091-79350113 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
993695595 5:91058151-91058173 GAGTTTAAACAGTCAGGTGCTGG + Intronic
995797033 5:115952276-115952298 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
996198743 5:120643417-120643439 GAGTTTAAACATCCAGTTACTGG - Intronic
996952578 5:129145628-129145650 GAGGTTAAAGAGATAGATGTTGG - Intergenic
997117397 5:131139808-131139830 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
997784214 5:136692987-136693009 AAGGTTGGACAGACAGTTTCTGG + Intergenic
997902772 5:137783293-137783315 AAGGTTGCACAGGCAGTTGCTGG - Intergenic
998000079 5:138618172-138618194 GAGCTTGGACAGGCAGTTGCTGG + Intronic
999608655 5:153345202-153345224 GAGGTAAAACTGTCAGTTGTGGG - Intergenic
1000140318 5:158397073-158397095 GAGGTAAAACAGAAAGGTACAGG - Intergenic
1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG + Intronic
1002004382 5:176220232-176220254 GAGTTTACCAAGACAGTTGCAGG - Intergenic
1002221989 5:177690397-177690419 GAGTTTACCAAGACAGTTGCAGG + Intergenic
1002420232 5:179142363-179142385 GAAGTTAAACAGACAGAACCAGG + Intronic
1003612307 6:7624971-7624993 GTGGTTGGACAGGCAGTTGCTGG - Intergenic
1004071603 6:12303304-12303326 GAGGCTAGACAGGCAGTTGCTGG - Intergenic
1004231467 6:13837539-13837561 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1005026440 6:21466996-21467018 GAGGTCACACAGACAGTTGAAGG - Intergenic
1005520104 6:26593621-26593643 GAGGTTGGACAGGCAGTTGTGGG - Intergenic
1005652856 6:27900485-27900507 AAGGTTAGACAGACAGTTACTGG + Intergenic
1005668244 6:28079431-28079453 GAGGTTAGACAAACAGTTGCTGG - Intergenic
1006073809 6:31516369-31516391 GAGGTTAGAGAGACAGATGAGGG - Intergenic
1008572203 6:52826715-52826737 AAGTTTAAACAGGCAGTTGATGG - Intergenic
1009838788 6:69040106-69040128 GAGGTTAGACAGACAGTTGCTGG + Intronic
1010559697 6:77333921-77333943 GAGGTTATGCAGACAATTGGTGG - Intergenic
1010764184 6:79760037-79760059 GAAGTTAAACAGGCAGTTGCTGG + Intergenic
1011134559 6:84086303-84086325 CAGGTTGGACAGGCAGTTGCTGG + Intronic
1011415487 6:87115548-87115570 GAGGTTGAGCAAGCAGTTGCTGG - Intergenic
1011731974 6:90274049-90274071 GAGATTAAACAGACAGATAGGGG + Intronic
1012652249 6:101769933-101769955 GAGGTTAGACAGGCAGTTGCTGG + Intronic
1013814671 6:114083479-114083501 GAGGTCAAAGAGACAGCTCCAGG + Intronic
1014155915 6:118109631-118109653 GAGAATAAACAAACATTTGCTGG + Intronic
1014849383 6:126322711-126322733 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1014850487 6:126334747-126334769 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1015046728 6:128785221-128785243 GAGGGTTGACAGCCAGTTGCTGG + Intergenic
1015204824 6:130624364-130624386 GAGGTTGGACAGGTAGTTGCTGG - Intergenic
1015214505 6:130734378-130734400 GAGCTTGGACAGGCAGTTGCTGG - Intergenic
1015736420 6:136405138-136405160 AACATTAAACAAACAGTTGCTGG + Intronic
1016941086 6:149483145-149483167 GAGGCCAAACAGAAAGTTTCTGG + Intronic
1017396242 6:154002814-154002836 GAGGTTACACAGACAACTGTAGG + Intergenic
1018585681 6:165355373-165355395 GAATTTAAACTGGCAGTTGCTGG - Intronic
1018753414 6:166827309-166827331 GAGGTTGGACAGGCAGTTTCGGG - Intronic
1021034024 7:15774662-15774684 GAGGTTGCACAGACACTTGAAGG - Intergenic
1021730973 7:23595544-23595566 TAGGTTCAACAGGCAGTTGCTGG - Intergenic
1021869262 7:24987451-24987473 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1022565264 7:31393387-31393409 GAGGTTGGAAAGGCAGTTGCTGG - Intergenic
1023529008 7:41134178-41134200 GAGGTTGTACACACAGTTACAGG - Intergenic
1024470223 7:49761789-49761811 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1026195575 7:68170589-68170611 GAGGTTAAACACACTCTGGCTGG + Intergenic
1026712826 7:72757824-72757846 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029311802 7:99674186-99674208 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029316671 7:99721946-99721968 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029322564 7:99777676-99777698 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029328163 7:99827708-99827730 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1030104946 7:105979245-105979267 GGGGTCAAACACACAGATGCTGG - Intronic
1030672039 7:112348527-112348549 GAAGTTAAACACAAAGTTTCTGG - Intergenic
1031085237 7:117296101-117296123 GAGGTTAAACAGCTAGTGACTGG + Intronic
1031493614 7:122420058-122420080 GAGGTTATACAGTTTGTTGCTGG + Intronic
1032419074 7:131763297-131763319 GAGGTTAAACAGGCAGTTGCTGG - Intergenic
1033003677 7:137536685-137536707 GATGTTACACAGACAAATGCAGG + Intronic
1033344380 7:140515906-140515928 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1034392467 7:150797562-150797584 AGGGTTAGACAGGCAGTTGCTGG + Intronic
1034445090 7:151109996-151110018 GAGGTTAAGGAGACCGTGGCTGG + Intronic
1034700314 7:153089579-153089601 GAGGCTGGACAGGCAGTTGCAGG + Intergenic
1035444529 7:158931103-158931125 GAGGTTAAACTTAAAGTTTCAGG + Intronic
1036731127 8:11265840-11265862 GAGGTCAGACAGGCAGCTGCTGG - Intergenic
1038777359 8:30543096-30543118 GTGGTTTAACATACTGTTGCTGG - Intronic
1040384304 8:46903325-46903347 GAGGTGAAACAGGAAGGTGCTGG - Intergenic
1040509433 8:48081129-48081151 GAGGATACACTGACAGTTGAAGG - Intergenic
1040959413 8:53015341-53015363 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1040965691 8:53078643-53078665 AAGGTTGGACAGTCAGTTGCTGG - Intergenic
1041798992 8:61777655-61777677 GAGGTTAGACAGGCAGATGCTGG + Intergenic
1042069048 8:64910620-64910642 GAGATTAGACATGCAGTTGCTGG - Intergenic
1042716733 8:71781353-71781375 GAGATTGGACAGGCAGTTGCTGG + Intergenic
1043909991 8:85852989-85853011 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1044057165 8:87585657-87585679 GAGGTTGGACAGGCAGTTGTTGG - Intronic
1044624248 8:94220714-94220736 GCAGTTGAACAGGCAGTTGCTGG - Intergenic
1045267706 8:100634392-100634414 GAGGTTAAAAAAAAAGTTTCTGG - Intronic
1045507046 8:102786163-102786185 GAGGTGGCACAGACAGTAGCGGG - Intergenic
1045803001 8:106123265-106123287 GAGGTCAAACAGATAGCTGAAGG + Intergenic
1047740091 8:127799557-127799579 GAAGGAAAACAGACAGTAGCAGG + Intergenic
1047936705 8:129787744-129787766 AAGGTTAGACAGGCAGTTGGTGG + Intergenic
1047947795 8:129899801-129899823 GAGGCTGAACAGGCAGTTGCTGG + Intronic
1047964169 8:130033397-130033419 GAGATTGGACAGGCAGTTGCTGG - Intergenic
1050454407 9:5819482-5819504 GAGATTGGACAGGCAGTTGCTGG - Intronic
1052136929 9:24923933-24923955 GAGGGTAAACACCCAGTTTCTGG + Intergenic
1054830257 9:69617078-69617100 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1055708453 9:79033597-79033619 GAGGTTGCACAGACACTTGAAGG + Intergenic
1057078798 9:92156400-92156422 GAGGTTGGACAGGCAGTTGTTGG + Intergenic
1057790328 9:98120174-98120196 AAAGTTGAACAGGCAGTTGCTGG + Intergenic
1058033713 9:100227796-100227818 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1058154484 9:101499597-101499619 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1058648801 9:107155610-107155632 GAGGTTACACAGCCAGTAGGTGG - Intergenic
1060289343 9:122286092-122286114 AAGGTCAAACAGCCAGTTGGTGG - Intronic
1060324556 9:122600649-122600671 GAGGTGAGACAGGTAGTTGCTGG - Intergenic
1061740212 9:132697982-132698004 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1062695926 9:137876487-137876509 GGGGTTAAAGAGACACTTGCAGG + Intergenic
1187180288 X:16937682-16937704 AAGTTTAGACAGGCAGTTGCTGG - Intergenic
1188240346 X:27779803-27779825 GAGGTCAAACAGGCAGATCCAGG - Intergenic
1188458440 X:30394498-30394520 AAGGTTGAACAGATAGTTGCTGG - Intergenic
1191021057 X:55860415-55860437 GAGGTTAAACAGGCAGATGCTGG + Intergenic
1195762286 X:108259550-108259572 ATGGTTACACAGACAGTTGGTGG - Intronic
1195853209 X:109305436-109305458 GAGGTCACACAGACACTTGAAGG + Intergenic
1195854076 X:109311362-109311384 GAGGTCACACAGACATTTGATGG + Intergenic
1196362856 X:114887177-114887199 GAGGTTAGACAGGTAGTTGCTGG + Intronic
1196798189 X:119519211-119519233 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1197305231 X:124833539-124833561 AAGGTTAATGAGACAGTTGGAGG - Intronic
1199494368 X:148436741-148436763 GAGGTTAAAGAGACAAGTGTGGG - Intergenic
1200423764 Y:3000113-3000135 GAGGTTGAATAGGCAGTTGTTGG - Intergenic