ID: 915766227

View in Genome Browser
Species Human (GRCh38)
Location 1:158365379-158365401
Sequence AATCCTATCAGGCTGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915766223_915766227 -5 Left 915766223 1:158365361-158365383 CCTCTGGTGACCATTAGAAATCC No data
Right 915766227 1:158365379-158365401 AATCCTATCAGGCTGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915766227 Original CRISPR AATCCTATCAGGCTGCTGAT GGG Intergenic
No off target data available for this crispr