ID: 915772490

View in Genome Browser
Species Human (GRCh38)
Location 1:158442542-158442564
Sequence GAGGATGACCATGATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915772490_915772494 22 Left 915772490 1:158442542-158442564 CCATCACCATCATGGTCATCCTC No data
Right 915772494 1:158442587-158442609 GTGTTATTCTCTGAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915772490 Original CRISPR GAGGATGACCATGATGGTGA TGG (reversed) Intergenic
No off target data available for this crispr