ID: 915773907

View in Genome Browser
Species Human (GRCh38)
Location 1:158461588-158461610
Sequence CTGGGAGTCCTGATAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915773901_915773907 25 Left 915773901 1:158461540-158461562 CCACGTTGGTCATCAGAACTTCT No data
Right 915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG No data
915773900_915773907 26 Left 915773900 1:158461539-158461561 CCCACGTTGGTCATCAGAACTTC No data
Right 915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915773907 Original CRISPR CTGGGAGTCCTGATAGATGG AGG Intergenic
No off target data available for this crispr