ID: 915774355

View in Genome Browser
Species Human (GRCh38)
Location 1:158466289-158466311
Sequence AACAGTTACCACAATGAGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915774355_915774357 10 Left 915774355 1:158466289-158466311 CCCATCTCATTGTGGTAACTGTT 0: 1
1: 0
2: 0
3: 6
4: 145
Right 915774357 1:158466322-158466344 GTGCCTCTTTCATCTACTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915774355 Original CRISPR AACAGTTACCACAATGAGAT GGG (reversed) Exonic
901386164 1:8910739-8910761 AACAATTAAAACAATGAGGTTGG + Intergenic
902359035 1:15932021-15932043 AAGAGTGACCAGAAAGAGATTGG + Exonic
904906925 1:33904457-33904479 AACAGTAGCGACAAGGAGATGGG - Intronic
908954022 1:69599218-69599240 AACATGTACCACAAAGAAATGGG - Intronic
911439529 1:97908204-97908226 AACACATACCAAAATTAGATTGG - Intronic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
915774355 1:158466289-158466311 AACAGTTACCACAATGAGATGGG - Exonic
915776349 1:158491940-158491962 GACAATGACTACAATGAGATGGG - Intergenic
915919900 1:159968308-159968330 AAGAATTACAAAAATGAGATGGG - Intergenic
921388719 1:214598179-214598201 AACAGTCACATCAATTAGATTGG + Intergenic
922115582 1:222609681-222609703 AATAGTTACAACAATGTCATGGG - Intergenic
923090680 1:230738756-230738778 AACCTTTACCACAAAAAGATGGG + Intergenic
924842107 1:247723300-247723322 AACAGTGAAAACAGTGAGATGGG + Exonic
1064699832 10:18007424-18007446 AACAGTTACCATGAGGAGTTAGG - Intronic
1066748455 10:38627485-38627507 AAAAGTTCCCACAGTGAGTTTGG + Intergenic
1067498309 10:46778475-46778497 AACAGAGACCTGAATGAGATGGG - Intergenic
1067596337 10:47561940-47561962 AACAGAGACCTGAATGAGATGGG + Intergenic
1069921559 10:71818799-71818821 AACAGTTTCCAGAAGGAGCTAGG + Intronic
1074489039 10:113922356-113922378 AAAACTTACCACAATGAGTGAGG + Intergenic
1078042138 11:7876951-7876973 AACAGTAACCACAATAAAATTGG + Intergenic
1079924758 11:26480210-26480232 AACACTTTCCACACTGAGCTGGG + Intronic
1079994013 11:27276135-27276157 AAGAGTTACCAAACCGAGATTGG + Intergenic
1080803092 11:35626896-35626918 AACAGTAATCACCCTGAGATTGG + Intergenic
1080803506 11:35631088-35631110 AGCCCTTACCACTATGAGATAGG - Intergenic
1083116549 11:60465207-60465229 AACAAGTACCATAATGATATGGG - Intronic
1090217872 11:124986243-124986265 AAAAGTTACCACAAAGTTATAGG - Intronic
1090819213 11:130326035-130326057 AACAGTAAGGACCATGAGATGGG - Intergenic
1092204105 12:6605420-6605442 AACAGTTCCCCCAATCAGACAGG + Intronic
1093675116 12:21929681-21929703 AGCAGTTTCCAGAATAAGATGGG + Intronic
1093703798 12:22253096-22253118 AAGAGTTGCCACAATGGGAAGGG + Intronic
1096074897 12:48797205-48797227 AACAGCTACCACATTGTGACAGG - Intergenic
1096945375 12:55401250-55401272 AACAGAAACCACAATCATATGGG - Exonic
1098474681 12:70886827-70886849 TCCAGTGACCACAATGATATAGG - Intronic
1099461909 12:82932817-82932839 AACAGGTATCACAAAGAGGTGGG - Intronic
1102968126 12:117144444-117144466 AGCAGTTACTAGAAAGAGATGGG - Intronic
1103240210 12:119407031-119407053 AACAGTCACCACAATGCCAGTGG + Intronic
1105222024 13:18339173-18339195 AACACTGACCACACTGAGACAGG - Intergenic
1107238880 13:38209044-38209066 AACAGTAAGCACAATAAGAAAGG + Intergenic
1107675583 13:42793541-42793563 AACAGTTACCTGAGTGAGCTTGG - Intergenic
1108129411 13:47281368-47281390 AACAGCTACCATAACGGGATTGG - Intergenic
1108576279 13:51794341-51794363 AGCAGTTCCCACAATGAGCACGG + Intronic
1109234931 13:59804314-59804336 GACAGTTACCACAATCATTTTGG + Intronic
1109450492 13:62507674-62507696 AATAAAAACCACAATGAGATAGG - Intergenic
1113307674 13:109095880-109095902 AACAGTAACCACTATGATATTGG - Intronic
1114769525 14:25412351-25412373 AACATATTCCAGAATGAGATAGG - Intergenic
1114806446 14:25842432-25842454 TACAGTAACCACAATGCTATGGG + Intergenic
1115542372 14:34433554-34433576 AATTGATACCACAATTAGATAGG - Exonic
1119118069 14:72045716-72045738 AAAAGCTCCCATAATGAGATAGG + Intronic
1120757720 14:88259615-88259637 AAAAGTTACAAAAATTAGATGGG - Intronic
1123191149 14:106572136-106572158 AACAATAACAACAATGAAATAGG - Intergenic
1126705327 15:51400520-51400542 TACAGTTACCACACAGATATGGG - Intronic
1128656458 15:69465947-69465969 AACAGTTTCTACAATTAGAAAGG + Intergenic
1130669880 15:85902209-85902231 TACAGTTACCACATTGTGTTTGG + Intergenic
1134446304 16:14333853-14333875 AAAAGTTACAACAATTAGCTGGG + Intergenic
1137804931 16:51296071-51296093 TACAGTTGCTACAAGGAGATGGG - Intergenic
1137807639 16:51322417-51322439 AGCTGTTCCCACAATGTGATAGG - Intergenic
1138008190 16:53356381-53356403 AACAGTTAACAGAATCATATTGG - Intergenic
1203018776 16_KI270728v1_random:379784-379806 AAAAGTTCCCACCATGAGTTTGG + Intergenic
1203037111 16_KI270728v1_random:652942-652964 AAAAGTTCCCACCATGAGTTTGG + Intergenic
1143749601 17:9018853-9018875 AACAGTCACAACAGTGAGCTCGG - Intergenic
1146413598 17:32611072-32611094 AACAGTGAACACAACTAGATAGG + Intronic
1155002029 18:21697056-21697078 AAAAGTTAATAGAATGAGATGGG - Intronic
1155526306 18:26719515-26719537 AAGAATTTCCACAATGAAATTGG + Intergenic
1155694319 18:28666668-28666690 AAAAATTACCAAAATTAGATAGG + Intergenic
1157958628 18:52126937-52126959 AACAGTTCCATCAATAAGATGGG - Intergenic
1159176647 18:64844696-64844718 CAATGTTACCACAATGGGATGGG + Intergenic
1164445421 19:28313625-28313647 AACACTTACTACAATGATAAAGG + Intergenic
1164850740 19:31481957-31481979 AACATTTACCACAATAGGAGTGG + Intergenic
1167637523 19:50663504-50663526 AAAAGCTACCACAATGGGATGGG - Intronic
1167956053 19:53064768-53064790 AACAATTACCACAAAGTGAGTGG - Intergenic
928918124 2:36496079-36496101 AACAGTTACTCCAATTACATAGG + Intronic
929743666 2:44632293-44632315 AAAAGTTACTACAATGATAAAGG - Intronic
932685196 2:73863232-73863254 AACAGCCAACACAATGAAATTGG - Exonic
936772414 2:115930249-115930271 AACAGTTACCACAAATAAAGAGG - Intergenic
937515247 2:122647030-122647052 AAAAGATACCACAATCAGAAAGG - Intergenic
940587375 2:155670462-155670484 AGGGGGTACCACAATGAGATGGG - Intergenic
941317665 2:164014971-164014993 ACCATTTACCACAATCAAATCGG + Intergenic
941322148 2:164069286-164069308 AACAGCCACCACCATGATATAGG - Intergenic
942697756 2:178664977-178664999 AACAGTAACCACAATAAGTTAGG + Intronic
943807331 2:192138175-192138197 TACAGTTACTACAATGTGTTAGG + Intronic
943949816 2:194119271-194119293 AACAATTACCAAAATTAGCTGGG + Intergenic
945335801 2:208591707-208591729 AACAGTTGCCAAAATGCCATCGG + Intronic
945506689 2:210650446-210650468 AACAGTCACTACAAAGAAATTGG - Intronic
946423534 2:219578960-219578982 GACAGTTACCACAAAAAGGTGGG + Intergenic
946668249 2:222074086-222074108 AAGAGTTCCCAAAATAAGATAGG - Intergenic
948226266 2:236311466-236311488 AAATGTGACCAGAATGAGATAGG - Intergenic
1178009476 21:28266741-28266763 AAAAATTAGCACAATGAGGTGGG - Intergenic
1179810961 21:43869521-43869543 AGCAGGTGCCACGATGAGATGGG + Intronic
1179966529 21:44810024-44810046 AGCAGTTACCACCATGACTTTGG + Intronic
1185213427 22:49585042-49585064 AACAGTGACCCTAATGAGCTGGG + Intronic
949910174 3:8897628-8897650 ATCAGTTACCAGAATCAAATGGG + Intronic
950248253 3:11441572-11441594 AACAGTTACCTCTAAAAGATTGG - Intronic
951612941 3:24511774-24511796 AACATGTACCAGAATGAGGTTGG - Intergenic
952623925 3:35381096-35381118 ACCAGTTAAGACAATGAGATGGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957004610 3:74930118-74930140 GACAGTTTCCATGATGAGATTGG + Intergenic
957236308 3:77596711-77596733 AACAGTGGCCCAAATGAGATTGG + Exonic
959375337 3:105582650-105582672 AACAGTAACAACGATGAGAGGGG + Intergenic
960183828 3:114614715-114614737 AAAAGTGGCCACTATGAGATTGG - Intronic
960197135 3:114782326-114782348 AACAGTTACTACAATGGGGGAGG + Intronic
961774683 3:129276472-129276494 AACAGTTAACAAAAGGAAATGGG + Intronic
967324345 3:188224326-188224348 TACAGTGACAACAATGAAATGGG + Intronic
968067313 3:195765727-195765749 AATAGTTTCCAAAATGTGATAGG - Intronic
969550264 4:7861475-7861497 AACAGTGATCACAATGGAATGGG - Intronic
969962658 4:10961111-10961133 ACACGTGACCACAATGAGATAGG + Intergenic
970768668 4:19583492-19583514 AATAGTTACCAAACTGAAATAGG + Intergenic
971260152 4:25049518-25049540 AAAAGTTACCACAATCAAGTAGG - Intergenic
976203326 4:82600563-82600585 AACAGTGACCAAAGTCAGATTGG + Intergenic
977126590 4:93176289-93176311 AGCAGTAAGCAAAATGAGATTGG - Intronic
979117157 4:116840140-116840162 AACAATTACCAAAACGAGAGTGG + Intergenic
981478807 4:145214505-145214527 AACATTTACCAGTATGATATAGG - Intergenic
982899698 4:160982522-160982544 AGCAATTACCACAATCAAATTGG + Intergenic
983829251 4:172303892-172303914 AGGATTTATCACAATGAGATGGG - Intronic
986568396 5:9138901-9138923 AACAGTAACCTGGATGAGATTGG - Intronic
987245015 5:16039976-16039998 GACAGTTACCAGAATGGGAAAGG - Intergenic
990017003 5:51075647-51075669 AACAGTTACGACAGTGTGCTTGG + Intergenic
990846873 5:60151143-60151165 TACACTTATCACATTGAGATGGG - Intronic
990915185 5:60895673-60895695 AACAATTTGCACAATGATATGGG + Intronic
993514466 5:88813509-88813531 AACAGTTACCACAGTTAAAATGG - Intronic
995341698 5:111068071-111068093 AATAGTTGCCAAAAGGAGATTGG - Intergenic
997770708 5:136550350-136550372 AGCAGTTATCAGCATGAGATTGG + Intergenic
1004584291 6:16984576-16984598 AAGAGTTACAAGACTGAGATTGG - Intergenic
1005657620 6:27957968-27957990 AAGAGACACCACAATTAGATGGG - Exonic
1005787654 6:29262823-29262845 GATGGATACCACAATGAGATGGG + Intergenic
1010641848 6:78338575-78338597 AACAGTTTCATCAATGAAATTGG + Intergenic
1010949655 6:82020269-82020291 AACAGTTACAGGAAGGAGATTGG - Intergenic
1012512855 6:100024679-100024701 AACAGTAATCATAAAGAGATAGG + Intergenic
1014304366 6:119721970-119721992 AACAGTGACCTGGATGAGATTGG - Intergenic
1014954594 6:127599585-127599607 ACCAGTTTGCACAATGAGAGGGG + Intergenic
1017537102 6:155359709-155359731 ATCATTTACCACAATCAAATGGG + Intergenic
1017835594 6:158174704-158174726 AACAGTTGCCACAATTGGTTTGG + Intronic
1021980286 7:26047594-26047616 AATAGCTACCACCATGAAATTGG + Intergenic
1022177825 7:27889061-27889083 CATAGATACTACAATGAGATGGG + Intronic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1028235283 7:88353890-88353912 AACAATTGCCACAAGGAGAAAGG - Intergenic
1034064882 7:148126727-148126749 AACAGTGACCACAATATGAACGG + Intronic
1034109511 7:148522638-148522660 AAGAGAGATCACAATGAGATGGG + Intergenic
1039952040 8:42180241-42180263 GACACTTACGACAATGACATTGG - Exonic
1043507473 8:80916490-80916512 AAAAGTTACCATGATGAGAGAGG - Intergenic
1044949364 8:97420140-97420162 AACATGTCCCACAAGGAGATAGG - Intergenic
1046255106 8:111686428-111686450 AACAGAAACCATAATGAGTTTGG - Intergenic
1048984022 8:139721378-139721400 AAAATTTACCACAAAGAGAGTGG - Intergenic
1050342416 9:4654262-4654284 TACAGTTACCACATTGAAATGGG + Intronic
1050655243 9:7821180-7821202 AACAGTGACAACAATAAGAAAGG + Intronic
1052524134 9:29591129-29591151 GACAGTTACCACAGACAGATGGG - Intergenic
1053318368 9:37072676-37072698 AACAGTTTCTACAATAACATTGG + Intergenic
1056050024 9:82758522-82758544 GCCAGTTACCAGAATGAGCTAGG - Intergenic
1190483724 X:50903363-50903385 AACACCTAACACAATCAGATAGG + Intergenic
1190568040 X:51751095-51751117 AACAGTTCCCACCATCAGACTGG + Intergenic
1191950357 X:66584604-66584626 CACAGTGACCTCGATGAGATTGG - Intergenic
1193487044 X:82098493-82098515 AACAAGTACCACAATGAGTGGGG - Intergenic
1194146736 X:90275631-90275653 AAAAATTATCACAATGAAATTGG - Intergenic