ID: 915778563 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:158519233-158519255 |
| Sequence | CGTTGCACTAGGCAGAGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915778560_915778563 | -8 | Left | 915778560 | 1:158519218-158519240 | CCTGAAGGGAAACACCGTTGCAC | No data | ||
| Right | 915778563 | 1:158519233-158519255 | CGTTGCACTAGGCAGAGATCAGG | No data | ||||
| 915778559_915778563 | 4 | Left | 915778559 | 1:158519206-158519228 | CCTGAGAAGCATCCTGAAGGGAA | No data | ||
| Right | 915778563 | 1:158519233-158519255 | CGTTGCACTAGGCAGAGATCAGG | No data | ||||
| 915778556_915778563 | 28 | Left | 915778556 | 1:158519182-158519204 | CCAACAAAAAAGAGGATGAGCTC | No data | ||
| Right | 915778563 | 1:158519233-158519255 | CGTTGCACTAGGCAGAGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915778563 | Original CRISPR | CGTTGCACTAGGCAGAGATC AGG | Intergenic | ||