ID: 915778563

View in Genome Browser
Species Human (GRCh38)
Location 1:158519233-158519255
Sequence CGTTGCACTAGGCAGAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915778560_915778563 -8 Left 915778560 1:158519218-158519240 CCTGAAGGGAAACACCGTTGCAC No data
Right 915778563 1:158519233-158519255 CGTTGCACTAGGCAGAGATCAGG No data
915778559_915778563 4 Left 915778559 1:158519206-158519228 CCTGAGAAGCATCCTGAAGGGAA No data
Right 915778563 1:158519233-158519255 CGTTGCACTAGGCAGAGATCAGG No data
915778556_915778563 28 Left 915778556 1:158519182-158519204 CCAACAAAAAAGAGGATGAGCTC No data
Right 915778563 1:158519233-158519255 CGTTGCACTAGGCAGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915778563 Original CRISPR CGTTGCACTAGGCAGAGATC AGG Intergenic