ID: 915780204

View in Genome Browser
Species Human (GRCh38)
Location 1:158541587-158541609
Sequence AGGAGATGAGAGAGATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915780204_915780206 4 Left 915780204 1:158541587-158541609 CCTCTTTATCTCTCTCATCTCCT No data
Right 915780206 1:158541614-158541636 GAACGTCATTATGTATCTATTGG No data
915780204_915780207 16 Left 915780204 1:158541587-158541609 CCTCTTTATCTCTCTCATCTCCT No data
Right 915780207 1:158541626-158541648 GTATCTATTGGTCTGCTTGATGG No data
915780204_915780209 27 Left 915780204 1:158541587-158541609 CCTCTTTATCTCTCTCATCTCCT No data
Right 915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG No data
915780204_915780208 26 Left 915780204 1:158541587-158541609 CCTCTTTATCTCTCTCATCTCCT No data
Right 915780208 1:158541636-158541658 GTCTGCTTGATGGTGTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915780204 Original CRISPR AGGAGATGAGAGAGATAAAG AGG (reversed) Intergenic
No off target data available for this crispr