ID: 915780205

View in Genome Browser
Species Human (GRCh38)
Location 1:158541607-158541629
Sequence ATACATAATGACGTTCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915780205_915780208 6 Left 915780205 1:158541607-158541629 CCTTCTAGAACGTCATTATGTAT No data
Right 915780208 1:158541636-158541658 GTCTGCTTGATGGTGTCCCGTGG No data
915780205_915780209 7 Left 915780205 1:158541607-158541629 CCTTCTAGAACGTCATTATGTAT No data
Right 915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG No data
915780205_915780207 -4 Left 915780205 1:158541607-158541629 CCTTCTAGAACGTCATTATGTAT No data
Right 915780207 1:158541626-158541648 GTATCTATTGGTCTGCTTGATGG No data
915780205_915780210 15 Left 915780205 1:158541607-158541629 CCTTCTAGAACGTCATTATGTAT No data
Right 915780210 1:158541645-158541667 ATGGTGTCCCGTGGGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915780205 Original CRISPR ATACATAATGACGTTCTAGA AGG (reversed) Intergenic
No off target data available for this crispr