ID: 915780209

View in Genome Browser
Species Human (GRCh38)
Location 1:158541637-158541659
Sequence TCTGCTTGATGGTGTCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915780205_915780209 7 Left 915780205 1:158541607-158541629 CCTTCTAGAACGTCATTATGTAT No data
Right 915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG No data
915780204_915780209 27 Left 915780204 1:158541587-158541609 CCTCTTTATCTCTCTCATCTCCT No data
Right 915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915780209 Original CRISPR TCTGCTTGATGGTGTCCCGT GGG Intergenic
No off target data available for this crispr