ID: 915781996

View in Genome Browser
Species Human (GRCh38)
Location 1:158562686-158562708
Sequence GGCCTTCAGGAAGACAGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 351}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915781996_915782000 1 Left 915781996 1:158562686-158562708 CCATCACTGTCTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 30
4: 351
Right 915782000 1:158562710-158562732 CCTTCACCTCCTTGTTCCTCAGG 0: 2
1: 10
2: 16
3: 115
4: 2623
915781996_915782005 16 Left 915781996 1:158562686-158562708 CCATCACTGTCTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 30
4: 351
Right 915782005 1:158562725-158562747 TCCTCAGGCAGTAGATGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 154
915781996_915782004 15 Left 915781996 1:158562686-158562708 CCATCACTGTCTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 30
4: 351
Right 915782004 1:158562724-158562746 TTCCTCAGGCAGTAGATGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 257
915781996_915782007 27 Left 915781996 1:158562686-158562708 CCATCACTGTCTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 30
4: 351
Right 915782007 1:158562736-158562758 TAGATGGCTGGGTTGAAGAATGG 0: 1
1: 1
2: 1
3: 57
4: 756
915781996_915782003 11 Left 915781996 1:158562686-158562708 CCATCACTGTCTTCCTGAAGGCC 0: 1
1: 0
2: 3
3: 30
4: 351
Right 915782003 1:158562720-158562742 CTTGTTCCTCAGGCAGTAGATGG 0: 1
1: 1
2: 2
3: 41
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915781996 Original CRISPR GGCCTTCAGGAAGACAGTGA TGG (reversed) Exonic
900148608 1:1168735-1168757 GAGCTTCAGGAAGCCAGCGAGGG + Intergenic
900506828 1:3033503-3033525 TGCCAACAGGAGGACAGTGATGG + Intergenic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
901645306 1:10713852-10713874 GGCCTGCTGGAAGACAGAGAAGG - Intronic
901941525 1:12666017-12666039 GGCCTTCAGGAAGTGAATGGAGG - Exonic
903127525 1:21258015-21258037 GGGATTCAAGAAGACAGTGCTGG + Intronic
903291990 1:22319804-22319826 GACCTGCAGGAAGAGAGAGAGGG + Intergenic
903679148 1:25085442-25085464 GGCCTTCAGTAAGACAATCATGG - Intergenic
903811598 1:26037773-26037795 GGCGATCAGGATGACAGTGCTGG + Intronic
904355579 1:29936887-29936909 GGCCCTAAGGGACACAGTGAAGG - Intergenic
905229901 1:36508443-36508465 GCACTGCAGAAAGACAGTGAGGG + Intergenic
905502700 1:38452250-38452272 GGGCTTCATGAAGTCAGGGAGGG - Intergenic
906045761 1:42829898-42829920 TGCCTTCAGGATGACATGGAGGG + Intronic
906432512 1:45766565-45766587 TTCCTTTAGGAAGACAGTAAAGG + Intergenic
907274555 1:53310077-53310099 GGCCTTCAGGGGGACAGGAAGGG + Intronic
912248706 1:107988771-107988793 GGCCTTCATAAAAACAGAGATGG + Intergenic
912574007 1:110647883-110647905 GGCCTTCAGGAAATAAGAGAGGG - Intergenic
913490056 1:119370740-119370762 GGCCTTCAGAAACACAGTCTGGG + Intronic
913533170 1:119747597-119747619 AGCCTTGAGCAAAACAGTGAAGG + Intergenic
915015362 1:152728041-152728063 TGCCTTCAGGAAGTCTGTCATGG - Intergenic
915319180 1:155046944-155046966 GACCTTGAGGAGGACAGGGAGGG - Intronic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
916132896 1:161626865-161626887 GGCCTTCAGGAATAAGCTGACGG + Intronic
916715539 1:167443886-167443908 GGGCCTGAGGAAGACAGTCATGG + Intronic
917029013 1:170669286-170669308 GGGCTTCAGGCAGACAGCAATGG + Intronic
918723952 1:187893570-187893592 AGCCTTCAGGCAGAAAGTCAAGG - Intergenic
919981756 1:202646247-202646269 GCCCTGCAAGGAGACAGTGAGGG - Intronic
920084711 1:203406806-203406828 GGAATCCAGGAAGAGAGTGATGG - Intergenic
920299694 1:204981132-204981154 AGCCTTCAGAAAGACAGGGAAGG - Intronic
921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG + Intergenic
921245546 1:213235529-213235551 GACCTTCAGGAAGTGAGAGAGGG + Intronic
921368264 1:214395642-214395664 GGTCTCCATGAAGACAGGGAAGG - Intronic
922134146 1:222808225-222808247 GGGCTGCAGGAAGAAACTGAAGG + Intergenic
922825795 1:228517337-228517359 GGCCTTCAGGATGAGACGGAAGG + Intergenic
923915065 1:238492498-238492520 CGCCTGCTGGAAGACAGTGAGGG + Intergenic
923941934 1:238837482-238837504 GGCCTTCAGGAAGGCAGTTAAGG + Intergenic
1063013253 10:2047824-2047846 GGCCAGCAGGAAAACAGAGATGG - Intergenic
1063077675 10:2733025-2733047 GGCCTTCAGGAAGCAGGAGATGG - Intergenic
1063149274 10:3321936-3321958 GGCCTTCAGCAACAGACTGAAGG + Intergenic
1063168425 10:3484641-3484663 GGCCTGTAGGATGACAGTGAGGG + Intergenic
1063674012 10:8123692-8123714 AACCTTCCTGAAGACAGTGAGGG - Intergenic
1064876522 10:20001100-20001122 GGTCTAAAGGATGACAGTGATGG - Intronic
1067270462 10:44787382-44787404 GGCACTCAGGAAGCCAGGGAAGG + Intergenic
1067276115 10:44835665-44835687 GGCCTTGCAGGAGACAGTGATGG - Intergenic
1067531226 10:47075271-47075293 GGGCTTCAGAAAGAGAGAGATGG - Intergenic
1069713773 10:70507915-70507937 GGCCCTGAGGATGCCAGTGAAGG + Intronic
1069856702 10:71444946-71444968 GGCCTTCAGTAGGCAAGTGAGGG - Intronic
1070186784 10:74071415-74071437 GGCCAGCTGGCAGACAGTGAAGG - Intronic
1070558414 10:77547433-77547455 TGGCTTTAGGAAGACAGGGAGGG + Intronic
1071375608 10:84999447-84999469 GGAAATCAGGAAGACAGTAAAGG - Intergenic
1071388874 10:85149852-85149874 GGTCTGCAACAAGACAGTGAAGG + Intergenic
1073473954 10:103740847-103740869 GGCCTCCATCAAGACAGTGCTGG - Intronic
1073785552 10:106885557-106885579 GGCTATCTGGAGGACAGTGAAGG + Intronic
1074128458 10:110551492-110551514 GGTCCTGAGGAAGATAGTGAAGG - Intergenic
1075054610 10:119207940-119207962 GGCTTTCAGCAAGACCGTGTTGG - Exonic
1075261250 10:120965409-120965431 GGCCTTCATGAAAACACTGCTGG - Intergenic
1075906955 10:126089821-126089843 GGCCAAAAGGAAGACAGGGATGG - Intronic
1076381598 10:130027640-130027662 AGCGTTCAGGGAGACAGGGAAGG + Intergenic
1076855963 10:133115760-133115782 GGCCCTCTTGAGGACAGTGAGGG - Intronic
1077052672 11:574826-574848 GGGCTTCTGGAAGCCAGAGAGGG - Intergenic
1077662473 11:4082192-4082214 GGCCTTGAGGAAAGCAGAGAAGG + Exonic
1078335890 11:10462881-10462903 GGCCTTCTGGAAGAAACTGGGGG - Intronic
1078865775 11:15295996-15296018 TGACTTGAGAAAGACAGTGAAGG - Intergenic
1079234871 11:18681012-18681034 GGGCTCCATGAAGACAGGGAAGG + Intergenic
1079607881 11:22392410-22392432 GGCCTTCAGCAATAGACTGAAGG + Intergenic
1080868848 11:36218764-36218786 ACCATTCAGGCAGACAGTGAGGG - Intronic
1083859284 11:65411404-65411426 GCCCCTCAGGAGGACAGTGCCGG - Exonic
1083925927 11:65806526-65806548 GTCCTTCAGGAAGGCAATGTTGG + Intergenic
1084793259 11:71488456-71488478 GCCTTTCAGGGAGACAATGATGG - Intronic
1085140938 11:74140989-74141011 AACCTTAAGGAAGAAAGTGAAGG + Intronic
1085397439 11:76213748-76213770 GGGCTTAGGGAAGACAGAGAAGG - Intergenic
1085786111 11:79451735-79451757 GGCCGTTAGAAAGCCAGTGAAGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1087622533 11:100558855-100558877 GGCATTCAGGAAGGCAATGATGG + Intergenic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1090606086 11:128424386-128424408 GGCCTGGAGGCAGACAGGGAGGG - Intergenic
1091119191 11:133042581-133042603 GAGCTTCAGGAAGCCAGTGTGGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093653633 12:21672217-21672239 TCCCTTCAGGAAGAAAGTCAAGG + Intronic
1093680916 12:22002262-22002284 GGGTTTCAGGTAGTCAGTGATGG + Intergenic
1096664978 12:53158487-53158509 GGCCGGCAGCAAGACAGAGAAGG + Exonic
1097189515 12:57212772-57212794 TGCCTTCAGGGAGACAGGCAGGG + Exonic
1098831568 12:75371183-75371205 GGCCTTCAGCCACACACTGAAGG - Intronic
1100266591 12:92982489-92982511 GGCCTTCAGCCACAGAGTGAGGG + Intergenic
1101025168 12:100596138-100596160 GACCTTCTGGGAGACAGTCATGG - Intronic
1102212953 12:111140118-111140140 GTCTTTAAGGAACACAGTGAGGG - Intronic
1102496289 12:113321346-113321368 GCACTGCAGGAAGACAGGGAGGG + Exonic
1102885030 12:116515323-116515345 GGCCTAGAGTCAGACAGTGAAGG + Intergenic
1103011937 12:117464657-117464679 GGGCGTCAGGAAGGCACTGAAGG + Exonic
1103614432 12:122143182-122143204 GCCCTGCAGGAAGAGAGGGAGGG - Exonic
1104224144 12:126814529-126814551 GATCTCCAGGAAGACAGTGGAGG + Intergenic
1104359619 12:128120568-128120590 GGCCTTCAGGCAGACGGTCTGGG + Intergenic
1105070520 12:133231730-133231752 AGCCTTGGGGAAGGCAGTGATGG + Intronic
1105439174 13:20401688-20401710 CAGCTTCAGGAAGACAGTTATGG - Intergenic
1105513511 13:21071292-21071314 AGCCTTCAGAAAGACATTGGTGG + Intergenic
1105626409 13:22117277-22117299 GGGCTCCAGAAAGACAGGGATGG + Intergenic
1107079928 13:36364061-36364083 AGCAATCAGGAAGACTGTGATGG - Intronic
1107114330 13:36730569-36730591 GGCCTTTAGGGAGACAATTAAGG + Intergenic
1107353511 13:39541488-39541510 GGCCTGCAGGTAGGGAGTGAAGG - Intronic
1107490698 13:40877855-40877877 GGCCTCCCTGAAGATAGTGAGGG + Intergenic
1111926709 13:94470684-94470706 GGAATTTAGGGAGACAGTGAGGG - Intronic
1112407101 13:99130766-99130788 GGCCTTAAGAAAAACATTGAGGG - Intergenic
1112778162 13:102867719-102867741 TGCCTTCAGTAAGACAAGGAGGG + Intronic
1113709506 13:112454269-112454291 TTCCTTCAGGAAGACAGTCCTGG + Intergenic
1117269679 14:54129806-54129828 GGGCTTCAAGACGTCAGTGAAGG + Intergenic
1117649941 14:57893241-57893263 TAGCTTCATGAAGACAGTGAGGG - Intronic
1118001150 14:61525109-61525131 AGCCTTCTGGAATACAGTGCGGG + Intronic
1119521096 14:75285709-75285731 GTCATCCAGGAAGACAGTGAAGG - Intergenic
1120273023 14:82338332-82338354 GGCCTACAGGAAGGCAATAATGG + Intergenic
1122091378 14:99343157-99343179 AGCATTCTAGAAGACAGTGAAGG + Intergenic
1122989183 14:105228866-105228888 TGACTTCAGGAGGACTGTGAAGG - Exonic
1124681020 15:31730831-31730853 GGTCTACAGGAGGTCAGTGATGG + Intronic
1126986841 15:54321327-54321349 GGCATTAAAGAAGACATTGAAGG - Intronic
1127710670 15:61594658-61594680 GGACTTTAGGAAGCCAATGAAGG + Intergenic
1128803931 15:70516861-70516883 GGCCTTGGAGAAGACTGTGAGGG - Intergenic
1129268471 15:74407405-74407427 GGCCCTCAAGAAGCCAGTGCTGG + Intergenic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1131251886 15:90836494-90836516 GGTTTTCAGGAAGACAGCGTGGG + Intergenic
1132666854 16:1084907-1084929 GAGCTTCAGGAAGGCAGTGCTGG + Intergenic
1133617095 16:7487306-7487328 GGCGTGGAGCAAGACAGTGATGG - Intronic
1133711145 16:8402182-8402204 GGCCTGCAGCAGGACAGTGGTGG + Intergenic
1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG + Intergenic
1136390804 16:29963090-29963112 AGCCTGCTGGAAGACAGGGAGGG - Exonic
1139279626 16:65759266-65759288 GGCCTTCAGGAGGGCAGGGCTGG - Intergenic
1140055428 16:71521567-71521589 GGCCTCCAGGAAGATAGTGGTGG - Intronic
1141098112 16:81177343-81177365 GCTATTCAGGAAGACAGAGATGG - Intergenic
1141161926 16:81635007-81635029 GCCCTTCCGAAATACAGTGAGGG - Intronic
1142174713 16:88639759-88639781 GGCCTCCAGGAGGACAGGGTAGG + Intronic
1142236675 16:88925704-88925726 GGCAGTCGGGCAGACAGTGAAGG - Intronic
1143118178 17:4592217-4592239 AGCCCCCAGGAAGAAAGTGACGG - Intronic
1144128802 17:12226108-12226130 TGCCTTGAGGAAGAAACTGATGG + Intergenic
1144504856 17:15821305-15821327 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1144645916 17:16973295-16973317 GGCCCTTAGGAAGAAACTGAAGG + Intergenic
1145169029 17:20639188-20639210 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1145203591 17:20968627-20968649 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1146651036 17:34606587-34606609 GGCTTCCAGGAAGTCTGTGAGGG - Intronic
1148889870 17:50799835-50799857 GGCTCTCAGGAAGGCAGGGAAGG + Intergenic
1149743356 17:59069748-59069770 GGCCTTTAGGAAGATAATTAAGG + Intronic
1150006288 17:61470906-61470928 GGGCTTCAGGAAGTCAGGGAGGG + Intronic
1150325234 17:64251670-64251692 AGCCCTCAGGAAGAGAGAGAAGG + Intronic
1150610253 17:66727781-66727803 GGTCTTCAGGAAGACAGAGGAGG + Intronic
1151042550 17:70880109-70880131 GGACTTCTGGAAGACAGTAATGG + Intergenic
1151191642 17:72402604-72402626 GGCCTTCAGGCAGCCACAGATGG - Intergenic
1151281981 17:73083106-73083128 GGTCTTCAGGCAGACATGGAGGG - Intronic
1151297613 17:73197016-73197038 GGCCAGCAGGAAGTCTGTGAGGG - Exonic
1151773072 17:76177567-76177589 GGCCTTCAGGGAGGACGTGAAGG + Intronic
1152228219 17:79102419-79102441 AGCCCTCAGGCAGGCAGTGAAGG - Intronic
1152459976 17:80437392-80437414 GGGTTTCAGGAGGACAGTGGGGG + Exonic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1155813735 18:30275681-30275703 GGACTTCAGGAAGATAGTCTTGG - Intergenic
1157702130 18:49768084-49768106 GGACTTGAGGAAGAGAGAGAAGG - Intergenic
1157872335 18:51242001-51242023 GGCCATTAGAAAGCCAGTGAAGG + Intergenic
1158405877 18:57158527-57158549 GACCTGCAGGAAGCCAGGGAGGG - Intergenic
1158584078 18:58714770-58714792 GGCTTTCTGAAAGACAATGATGG + Intronic
1158973375 18:62688715-62688737 GGCCTAAATGAAGGCAGTGAGGG + Intergenic
1159017693 18:63115023-63115045 GGTCTCCAGGTAGACAGTGTTGG + Intergenic
1159531394 18:69660147-69660169 GGCCTTCAGGAAGAAAGTCGGGG - Intronic
1160622121 18:80178961-80178983 GACCTGCAGGGAGACAGAGAAGG + Intronic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1161361170 19:3850512-3850534 GGCCTTCAGGGAGGGAATGAAGG + Intronic
1162139288 19:8576297-8576319 TTCTTTCAGGAAGCCAGTGAGGG - Intronic
1162145207 19:8609085-8609107 GGCCAACAGGATGTCAGTGAGGG + Intronic
1163492973 19:17627796-17627818 GGCCTGCAGGGACACAGTGGTGG + Intronic
1164128572 19:22340832-22340854 TGCCCTCAGTAAGACAGAGAGGG - Intergenic
1164170896 19:22724499-22724521 TGCCCTCAGTAAGACAGAGAGGG + Intergenic
1165565828 19:36726827-36726849 TGGTTTCAGGAAGACTGTGAAGG - Intronic
1166286101 19:41829997-41830019 GGCATTAAAGAAGACACTGAAGG + Intergenic
1166294527 19:41882695-41882717 GGCTTTCGGGGAGAAAGTGATGG + Intergenic
1166478903 19:43152735-43152757 GGCCTTGAGGAGGACAGTTCTGG + Intronic
1166501574 19:43345073-43345095 GGCCTTGAGGAGGACAGTTCTGG + Intergenic
1166508540 19:43388385-43388407 GGCCTTGAGGAGGACAGTTCTGG - Intergenic
1166979687 19:46625193-46625215 GGCCCTCTGGAGAACAGTGAGGG - Intergenic
1168058772 19:53879029-53879051 GTCCTTTAAGAAGACAGCGATGG - Intergenic
1168512091 19:56981000-56981022 GGCCTTCAGGACGAGATGGATGG + Intergenic
1168512186 19:56981620-56981642 GGCCTTCAGGATGAGATGGATGG - Intergenic
925101570 2:1251044-1251066 GGCCTTCAGAACCACAATGATGG - Intronic
925307669 2:2861716-2861738 GGACTGCAGGGAGACAGAGACGG - Intergenic
925730323 2:6915670-6915692 GGGCTGCAGGAAGAGAGTTAAGG - Intergenic
926146565 2:10400100-10400122 GGCCTGCAGGAGGTCAGGGACGG + Intronic
926357508 2:12055037-12055059 GGGCTTCAGGGATACAGTGATGG + Intergenic
926613949 2:14976171-14976193 TGCCTCCAGGTAGAAAGTGAGGG - Intergenic
926796317 2:16622102-16622124 GGCACTCAGCAAGACAGTCAGGG - Intronic
927179855 2:20437315-20437337 GGGCTTAAGGAGGTCAGTGAAGG - Intergenic
927409042 2:22804616-22804638 GTCCTTGAGAAAGACATTGAAGG + Intergenic
927471536 2:23381220-23381242 GACTCTCAGGAAGACAGGGAAGG - Intergenic
929565370 2:42980467-42980489 TGCCTACAGAAACACAGTGATGG + Intergenic
932073987 2:68646135-68646157 GGCCACCAGGAAGTCAGAGATGG - Exonic
932667131 2:73707156-73707178 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932669794 2:73727674-73727696 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932740556 2:74287621-74287643 AGCCTTGAGGGACACAGTGAGGG - Intronic
933738571 2:85515125-85515147 GTCTTTGAGGAAGACAGTGAGGG + Intergenic
934542016 2:95183468-95183490 GGTCTTGAGGAAGGCAGTGATGG - Intronic
934978926 2:98824376-98824398 GGGCTTCAGGAGGCCAGAGAAGG - Intronic
936748379 2:115609428-115609450 AGTCATCAGGAAGATAGTGAAGG + Intronic
937693534 2:124782230-124782252 GGCCTTCAGGAATAAATGGAAGG - Intronic
937956589 2:127425139-127425161 GGCTTCCAGGAAGGCAGTGCAGG - Intronic
938510565 2:131937844-131937866 GGCTTACAGGAAAACTGTGAGGG - Intergenic
938740195 2:134224352-134224374 TGTCTTCTGGAAGACAGGGAGGG + Intronic
938803842 2:134787959-134787981 TCCCTCCAGGTAGACAGTGAAGG - Intergenic
939696028 2:145325926-145325948 GGCCTGCAGGAAAAGAGAGAAGG + Intergenic
940055478 2:149508357-149508379 GGCTTTCAAGAAGGCAATGACGG - Intergenic
940797319 2:158094172-158094194 TACCTTCAGGAAGAAAGTGAAGG + Intronic
943365769 2:186966361-186966383 GGGCTTCAGGAAGACCCTGGAGG + Intergenic
943836249 2:192517367-192517389 AGCCTGAAGGAAGCCAGTGATGG + Intergenic
944299898 2:198111718-198111740 GGCATACAGGAAGTGAGTGATGG + Intronic
945710157 2:213284764-213284786 GGCTCTCAGGAAGACTGTGGTGG - Intronic
945756513 2:213854031-213854053 GGATTTCAGGAACACACTGAGGG - Intronic
947729194 2:232418799-232418821 AGCCCTCTGGAAGGCAGTGAGGG - Intergenic
948197076 2:236104164-236104186 GGCCTGCAGGAAGAGGCTGAGGG + Intronic
948198808 2:236114733-236114755 GGTCTTCAGGAAGAGAATTAAGG - Intronic
948804605 2:240448107-240448129 GGTTTTCAGGAAGAGAGTCAAGG + Intronic
1171970199 20:31559700-31559722 GGCCTTCAGGAGCCCAGAGAAGG + Intronic
1174778142 20:53364447-53364469 GTCATTCAGGCAGAAAGTGATGG - Intronic
1175044040 20:56086939-56086961 GTCCTAGAGGAAGACAGAGATGG - Intergenic
1175465867 20:59191168-59191190 GGCCTTCAGGAACACAGTGGGGG - Exonic
1176389862 21:6157948-6157970 GGCCTTCTGGAAGGCGGTGGGGG - Intergenic
1178082201 21:29077299-29077321 GCCCTGCAGGAAGACAGCTAAGG + Intergenic
1178919027 21:36726348-36726370 GGCCTTCTGGAAGACACCGGTGG + Intronic
1179463848 21:41557522-41557544 TGCCTACAGGAAGACAGCTAGGG + Intergenic
1179733605 21:43380292-43380314 GGCCTTCTGGAAGGCGGTGGGGG + Intergenic
1180017413 21:45096413-45096435 GACCTGCAGGAAGACAGGCAGGG - Intronic
1180770591 22:18381395-18381417 GGACTGGAGAAAGACAGTGAGGG - Intergenic
1180808459 22:18738654-18738676 GGACTGGAGAAAGACAGTGAGGG + Intergenic
1180828534 22:18884353-18884375 GGACTGGAGAAAGACAGTGAGGG - Intergenic
1181071389 22:20343618-20343640 GGACTGGAGAAAGACAGTGAGGG + Intergenic
1181194461 22:21172568-21172590 GGACTGGAGAAAGACAGTGAGGG + Intergenic
1181214981 22:21320210-21320232 GGACTGGAGAAAGACAGTGAGGG - Intergenic
1183307526 22:37090583-37090605 GGCATTGAGCGAGACAGTGAGGG - Intronic
1183371653 22:37435909-37435931 TGCCTTGAGGAAGACTGGGAAGG + Intergenic
1183437911 22:37805859-37805881 GGCCTTCAAGAAGACCAAGAAGG + Exonic
1183654896 22:39178949-39178971 GGCCTTCAGGGAGGAGGTGACGG + Intergenic
1184803520 22:46776889-46776911 GGCCTGTAGGAAGACCTTGAAGG + Intronic
1184995016 22:48199210-48199232 GGGCCTGGGGAAGACAGTGAGGG + Intergenic
1185151057 22:49164217-49164239 AAGCTTCCGGAAGACAGTGAGGG + Intergenic
1203232426 22_KI270731v1_random:122567-122589 GGACTGGAGAAAGACAGTGAGGG - Intergenic
1203278628 22_KI270734v1_random:110342-110364 GGACTGGAGAAAGACAGTGAGGG - Intergenic
950428743 3:12938845-12938867 GGACTTCAGGAAGGCAGCAATGG + Intronic
950797036 3:15518641-15518663 GTCTTTCTTGAAGACAGTGAAGG + Intronic
950845585 3:16012579-16012601 GGCCCTAGGGAAGACAATGATGG + Intergenic
951293639 3:20904932-20904954 TGCTTTCAGGAAGAAAGGGAAGG + Intergenic
951839039 3:27013819-27013841 GCCAGTGAGGAAGACAGTGAGGG - Intergenic
953792364 3:45958019-45958041 GAGCTTCAGGAAGAGACTGAAGG + Intronic
954235773 3:49256100-49256122 GGCAGTGAGAAAGACAGTGATGG - Intronic
955034212 3:55250585-55250607 GACTTGCAGGAAGTCAGTGATGG + Intergenic
955513218 3:59701523-59701545 GGCCATCAGGGAAAGAGTGAGGG + Intergenic
955535242 3:59916319-59916341 GGCCTTCAGCAACAGACTGAAGG + Intronic
955868441 3:63410828-63410850 GACTTTGAGGAGGACAGTGATGG + Intronic
955986351 3:64577475-64577497 AGCCGTCTGGAAGACAGGGAGGG + Intronic
956166820 3:66403626-66403648 GGCACTCAGGAAGGCAGTGGCGG + Intronic
958450974 3:94271831-94271853 GGCCTTCTTGCAGAAAGTGAAGG - Intergenic
959151238 3:102610750-102610772 GTACTTCTGGAAAACAGTGAAGG + Intergenic
961017384 3:123478710-123478732 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017392 3:123478742-123478764 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017400 3:123478774-123478796 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017408 3:123478806-123478828 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017416 3:123478838-123478860 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017424 3:123478870-123478892 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017432 3:123478902-123478924 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017440 3:123478934-123478956 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017448 3:123478966-123478988 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017456 3:123478998-123479020 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017464 3:123479030-123479052 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017472 3:123479062-123479084 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
961017480 3:123479094-123479116 GGCTTTCAGGTGGACAGTGCTGG + Intergenic
966422151 3:179744587-179744609 GTTCTTCAGCAAGGCAGTGAAGG + Intronic
967289467 3:187904947-187904969 GGCTTTTGGGAAGACAGAGATGG - Intergenic
967317627 3:188164166-188164188 AGCCTTCAGTTAGACATTGAAGG + Intronic
969930858 4:10629379-10629401 GGCTTTCAGGAAGAGAGGGGAGG + Intronic
970738574 4:19204306-19204328 GGCCTTCAGTCAGGCAGGGAGGG + Intergenic
971481058 4:27115445-27115467 GGGCTCCAGGAAGAAAGAGAAGG + Intergenic
972254040 4:37334515-37334537 GGCCTTCAGCTAGATTGTGAAGG - Intronic
973727833 4:53793422-53793444 GACCATGAGGAAGAAAGTGAAGG - Intronic
975926203 4:79456708-79456730 GCTCTTCAGGGAGTCAGTGAAGG + Intergenic
976084242 4:81391118-81391140 GGCCATCATGAAGCCATTGATGG - Intergenic
976169256 4:82286004-82286026 GGCCTGCACTAAGACAATGATGG + Intergenic
982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG + Intronic
985130332 4:186732661-186732683 GGCCTTTAGGAAGGCAATTAAGG - Intergenic
985354383 4:189102206-189102228 GGCATTAATGAATACAGTGAGGG - Intergenic
986064471 5:4222303-4222325 AGCCTGCAGGAAGAAAGGGAGGG - Intergenic
987342127 5:16948567-16948589 AGCCTTCAGGAAGAAAAGGAAGG + Intergenic
987458672 5:18178907-18178929 GACCTTCACGAAGAAAATGAAGG + Intergenic
988530496 5:32023138-32023160 TGCCTTCAGGAAAAAAGGGAAGG - Intronic
989974131 5:50562266-50562288 GGTCTTCAGAAAGAAAGTCAGGG + Intergenic
990149536 5:52800585-52800607 GGCCTCCACGCAGAGAGTGAGGG - Exonic
990633434 5:57696006-57696028 GGCCCTCAGAAGGACAGAGAAGG - Intergenic
992192957 5:74312218-74312240 GTCCGCCAGGAAGACAGTGAGGG + Intergenic
993318352 5:86440358-86440380 GGCCTTCAGGCACAGACTGAAGG - Intergenic
994425203 5:99576552-99576574 GGCCTGCAGGAGCACAGGGATGG + Intergenic
994436136 5:99735681-99735703 GGCCTGCAGGAGCACAGGGATGG - Intergenic
994945399 5:106381364-106381386 CGCCTTCAGGGAGTCACTGATGG - Intergenic
997381821 5:133443887-133443909 GGTCTTAAGCAAGAGAGTGAGGG - Intronic
997829708 5:137139477-137139499 GGACTTCAGGAACAGAGGGAAGG + Intronic
998155668 5:139785522-139785544 GGCCATCAGGAAGGCAATGAGGG - Intergenic
998702458 5:144718561-144718583 GGACATCAGAAAGCCAGTGAAGG - Intergenic
999069170 5:148725452-148725474 AGGTTTCAGGAAGACAGTAAGGG + Intergenic
999319062 5:150602034-150602056 GGCCATCGGGGAGACAGTGGTGG + Intronic
999372185 5:151062666-151062688 GGACTGCAGGAAGTCAGGGAGGG - Intronic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
999776043 5:154813968-154813990 GGCCTGCTGGAAGACTGGGAGGG - Exonic
1000926013 5:167194971-167194993 GCCCTTTAGGAAGTAAGTGATGG - Intergenic
1001097145 5:168784403-168784425 GGCAGACAGGAAGACAGAGATGG + Intronic
1001680641 5:173554607-173554629 GGCCTCCTGGAAGACTGTGTTGG - Intergenic
1001935426 5:175700182-175700204 ACCCTTGAGGGAGACAGTGAGGG - Intergenic
1002358426 5:178649939-178649961 GGTCGTCAGGGAGACAGTGACGG + Intergenic
1002626407 5:180532635-180532657 TACCTCCAGGAAGACAGTGTTGG - Intronic
1003318339 6:5031295-5031317 GGCCTCCAGGCAGAAAGTGGAGG - Intergenic
1003567053 6:7230672-7230694 GGGTTCCAGGAAGGCAGTGAGGG - Exonic
1004410163 6:15374108-15374130 TTTCTTCAGGATGACAGTGATGG + Exonic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1006256669 6:32837991-32838013 GGCTCTCAGGGAGACAGTCAGGG + Exonic
1006408379 6:33857969-33857991 GTGCTCCAGGAAGACAGGGATGG - Intergenic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1007004695 6:38349776-38349798 AGACTTCAGGAACACAGGGAGGG + Intronic
1007321118 6:41029278-41029300 GGGCTTCAGGGAGGAAGTGATGG - Intronic
1008664898 6:53706488-53706510 GGCATTAAGGGAAACAGTGAGGG + Intergenic
1010099297 6:72084572-72084594 AGCATTCAGGAACACAGTGAAGG + Intronic
1010342298 6:74768383-74768405 GGCCTCCAGGAACTCAGTCAAGG + Intergenic
1011345569 6:86366312-86366334 GTACTTCCGGAAGACACTGAAGG - Intergenic
1011467319 6:87671630-87671652 GGCCAACAGCAAGACAGAGAAGG + Intergenic
1012032111 6:94084338-94084360 AGCCTTCACAAGGACAGTGACGG + Intergenic
1012311005 6:97723946-97723968 GGCCTTAAGAACAACAGTGAAGG - Intergenic
1012948931 6:105496663-105496685 GACCATGAGAAAGACAGTGATGG - Intergenic
1015232637 6:130933896-130933918 GCCCTACACGGAGACAGTGATGG - Intronic
1016322162 6:142857956-142857978 GGCCATCAGGAAGCCAATGGTGG - Intronic
1016651981 6:146472500-146472522 GGCCATCAGGAATGCAGTGCTGG - Intergenic
1017244560 6:152208469-152208491 TGCTCTCAGGGAGACAGTGAAGG - Intronic
1018117730 6:160604274-160604296 GGCCTCCAGGAAGAAAGCCAAGG + Intronic
1018343395 6:162876306-162876328 GGACAGCAGGAAGAGAGTGATGG - Intronic
1018385641 6:163300480-163300502 TCCCTGCAGGAAGAGAGTGAGGG - Intronic
1018469860 6:164085656-164085678 GGCATTCAGGAAGGGAGCGAAGG - Intergenic
1018774676 6:167001845-167001867 GGACTTCAGGGAGATGGTGAGGG - Intronic
1018955586 6:168408129-168408151 AGACTTCAGGAAGACAGAGAAGG - Intergenic
1020211115 7:6158838-6158860 GGGCTACTGGGAGACAGTGATGG + Intronic
1020498093 7:8881921-8881943 TGCCTTTATGAATACAGTGATGG + Intergenic
1020563831 7:9771141-9771163 GGCCTTCAAAAAGACAGAGGAGG + Intergenic
1021558093 7:21942013-21942035 GGCCTTCTGGTAGAGAGTGTGGG + Intronic
1021989886 7:26130974-26130996 TGCCTTCAGAAAGTCAGTCAAGG + Intergenic
1022466428 7:30655702-30655724 CGCCCCCAGGAAGGCAGTGAAGG - Exonic
1022472415 7:30689867-30689889 TGGATTCAGGAAGACAGGGAAGG + Intronic
1022596519 7:31718493-31718515 AAACTCCAGGAAGACAGTGATGG - Intergenic
1023267892 7:38427731-38427753 GGCCTCCTAGAAGATAGTGATGG + Intronic
1024616993 7:51124245-51124267 GGCCAGCAGGAAGACAGCAAAGG - Intronic
1026123645 7:67560042-67560064 GGGCTTTAGGAAGACAGAGGTGG - Intergenic
1027712521 7:81623505-81623527 GGGCTACAGGAAGAAGGTGAAGG + Intergenic
1028349808 7:89832224-89832246 GGCCTCCAAGAAGGAAGTGAAGG + Intergenic
1028716684 7:93979142-93979164 GGCTTTCAGGAAGACAGGAAGGG + Intronic
1030102239 7:105956621-105956643 GGGCTCCAGGAAGCCAATGAAGG + Intronic
1031159558 7:118150004-118150026 GGCCTTGAGGAAAAGAGAGATGG + Intergenic
1033305883 7:140225144-140225166 GGCCTTCAGGAAGACAGCCTTGG + Intergenic
1033861204 7:145630341-145630363 GGCCTTCAGCAACAGACTGATGG + Intergenic
1034190460 7:149209451-149209473 GTCCTTGATGAAGACAGGGAAGG - Intronic
1035313774 7:157985640-157985662 AGGCTTCAGGACCACAGTGATGG - Intronic
1035729525 8:1844429-1844451 GGCCTGCTGGACGACAGAGACGG + Intronic
1035938991 8:3875104-3875126 GGGCTTCAGGAACACATTGTGGG + Intronic
1036602981 8:10279796-10279818 GGCCTATATGAAGTCAGTGATGG - Intronic
1037703823 8:21298287-21298309 CACCTTCAGGAAGCAAGTGATGG + Intergenic
1037889137 8:22614072-22614094 GGGCTACAGGAAGACAGCAAGGG - Exonic
1038271296 8:26078219-26078241 GGACTTCAGGAAACCAGAGATGG + Intergenic
1038818907 8:30934258-30934280 GGCCTTCAAGGAGACAAAGAAGG + Intergenic
1039751513 8:40482838-40482860 GTCCTTGAAGAAGGCAGTGATGG + Intergenic
1039866848 8:41512376-41512398 CGCCTGCTGGAAGACAGCGAGGG + Intergenic
1040106510 8:43545133-43545155 GGCTTTCAGGGGGACATTGAGGG - Intergenic
1041262582 8:56034718-56034740 GGCCTTCAAGAAGAAAGGGCTGG + Intergenic
1042840983 8:73123610-73123632 GGCCTTCAGCAACAGACTGAAGG - Intronic
1048951847 8:139502842-139502864 AGCCTTCCAGAAAACAGTGAGGG + Intergenic
1052556640 9:30027156-30027178 GGCCTTCAGCTACACACTGAAGG - Intergenic
1053004999 9:34598665-34598687 GGACTTCCAGAAGACAGGGAAGG + Intergenic
1055265181 9:74487019-74487041 GGCCTTGAGAGAGACAGGGAAGG - Intergenic
1055697830 9:78906619-78906641 GGCCTTAAGCATGACACTGATGG + Intergenic
1056074031 9:83020207-83020229 GGGCATCAAGAAGAAAGTGAGGG + Intronic
1056323389 9:85457745-85457767 AGCATTCAGGTAGACAGTGAGGG + Intergenic
1056388231 9:86116904-86116926 ATTCTTCAGGAAGGCAGTGAGGG - Intergenic
1059711737 9:116873825-116873847 GAACAGCAGGAAGACAGTGAAGG - Intronic
1061672017 9:132194172-132194194 GGACTTCAGGAAGGGAGTGATGG + Intronic
1188814748 X:34698697-34698719 GGCCATCAGGAAAGAAGTGAAGG + Intergenic
1189061240 X:37755608-37755630 GGCCTACTGGAAAACAATGAGGG - Intronic
1191778393 X:64843190-64843212 GTTTTTCAGGAAGACAGAGATGG - Intergenic
1192330148 X:70168850-70168872 GGCCTTCAGGCAGACAGAACTGG - Intergenic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic
1197226808 X:123962059-123962081 TGCCTTGAGAAAGACAGTGCGGG - Intronic
1198052407 X:132961667-132961689 GCCTTTGAGGAAGACAGTAAAGG - Intergenic
1199558921 X:149141642-149141664 GACCTTCACAAAGACAGTGGTGG - Intergenic
1200071820 X:153532999-153533021 TGCATTCATGAAGACAGTGAGGG + Intronic
1201311079 Y:12598555-12598577 GTCTTTCAGGAAGACACAGATGG + Intergenic