ID: 915783334

View in Genome Browser
Species Human (GRCh38)
Location 1:158578945-158578967
Sequence AAATGCTTTTAGAAGAATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 514}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915783334_915783338 12 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783338 1:158578980-158579002 TTCCTCAGGCTGAATATGATGGG 0: 1
1: 0
2: 9
3: 48
4: 261
915783334_915783337 11 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783337 1:158578979-158579001 ATTCCTCAGGCTGAATATGATGG 0: 1
1: 0
2: 5
3: 46
4: 276
915783334_915783341 19 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783341 1:158578987-158579009 GGCTGAATATGATGGGGCTGAGG 0: 1
1: 3
2: 3
3: 25
4: 224
915783334_915783335 -2 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783335 1:158578966-158578988 TTTTCATGTCCTTATTCCTCAGG 0: 1
1: 0
2: 2
3: 49
4: 377
915783334_915783342 23 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783342 1:158578991-158579013 GAATATGATGGGGCTGAGGAAGG 0: 1
1: 4
2: 2
3: 41
4: 382
915783334_915783345 26 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783345 1:158578994-158579016 TATGATGGGGCTGAGGAAGGGGG 0: 1
1: 0
2: 3
3: 70
4: 802
915783334_915783343 24 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783343 1:158578992-158579014 AATATGATGGGGCTGAGGAAGGG 0: 1
1: 3
2: 2
3: 28
4: 305
915783334_915783339 13 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783339 1:158578981-158579003 TCCTCAGGCTGAATATGATGGGG 0: 1
1: 0
2: 7
3: 43
4: 270
915783334_915783344 25 Left 915783334 1:158578945-158578967 CCATCATTCTTCTAAAAGCATTT 0: 1
1: 0
2: 7
3: 44
4: 514
Right 915783344 1:158578993-158579015 ATATGATGGGGCTGAGGAAGGGG 0: 1
1: 0
2: 3
3: 26
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915783334 Original CRISPR AAATGCTTTTAGAAGAATGA TGG (reversed) Exonic
900353260 1:2247446-2247468 AAGTTCTTTTAGCAAAATGATGG + Intronic
900499230 1:2992180-2992202 AAAGGCATTTACAAGAATGTCGG - Intergenic
900627383 1:3615099-3615121 AAATTCATTTGGAAGAATGACGG - Intergenic
900767090 1:4512980-4513002 AAATGCTGTTAGCAGACAGATGG + Intergenic
903433966 1:23332203-23332225 AAAAGCTTTAAGAAGACAGATGG + Intronic
905223538 1:36465084-36465106 AAATGCTCTCAGAAAAGTGAGGG - Intergenic
905617370 1:39410223-39410245 AAATACTTTTGAAAGATTGATGG + Intronic
905675812 1:39824309-39824331 AGATGCTATTAGAAGGATCATGG + Intergenic
906903341 1:49861898-49861920 AAAAGCCTTTACAAGAAGGATGG + Intronic
908350527 1:63283032-63283054 TCATGTTCTTAGAAGAATGATGG - Intergenic
908760566 1:67507903-67507925 AAATGCTTATAGAGAAATCAAGG - Intergenic
909115851 1:71535450-71535472 AAAGGCTTTTAAAAGAATACAGG + Intronic
909725857 1:78834101-78834123 AAATGACCTGAGAAGAATGAAGG - Intergenic
910324155 1:85985352-85985374 TGATGCTTTTGGAAGAGTGATGG + Intronic
910327168 1:86023199-86023221 AAAAGGTTTCAGAAAAATGATGG - Intronic
910400267 1:86831221-86831243 AATGGCTTTTTGAGGAATGAAGG - Intergenic
910741375 1:90522010-90522032 AAATGTTTTCAACAGAATGAAGG + Intergenic
911219092 1:95228309-95228331 AAGTGCTTGTTGAAGAATAAAGG + Intronic
911324511 1:96454236-96454258 AAAAGCTTTTAGTAGAGTGTTGG + Intergenic
911585654 1:99687611-99687633 CAAAGCTTCTAGAAAAATGAAGG + Intronic
913272173 1:117105128-117105150 AAATGCTTTGAAAACCATGAAGG + Exonic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916216039 1:162395973-162395995 AAATGTATATAGAAGAATCAAGG + Exonic
916634886 1:166657866-166657888 AAATTCTTTTAGAAAAATATCGG - Intergenic
916711273 1:167411900-167411922 AAATGGTTTTGGAAGAATGGTGG - Intronic
917552532 1:176048869-176048891 AAATGCTGTCAAAAGAATTAAGG + Intronic
917981720 1:180273568-180273590 AAATTCTTTAAGAAAAAAGAAGG + Intronic
918247931 1:182676399-182676421 AATTGCTTTTAAAAGATTTACGG - Intronic
918418033 1:184332808-184332830 TAGTGCTTTTAGAAGACTGTAGG - Intergenic
918869248 1:189947026-189947048 AGAGTATTTTAGAAGAATGAAGG - Intergenic
919069062 1:192730889-192730911 AAATTCTTTTAGAACAATGAGGG - Intergenic
919187597 1:194173322-194173344 AATTGATTTTAGAAGACTTATGG + Intergenic
919278494 1:195452572-195452594 AAATGCTATTACCACAATGAAGG - Intergenic
919510750 1:198460680-198460702 AAATGCATTAGGAATAATGAGGG - Intergenic
919867828 1:201795659-201795681 AAGTGTTTTTGGTAGAATGATGG - Intronic
920641577 1:207756698-207756720 AAATGAATTTAGAAAAATGTGGG + Intronic
920896175 1:210051939-210051961 AATTGTTTTTAGAAGATTGTTGG + Intronic
921511685 1:216038894-216038916 AAGGGATTTTAGAAGAATCATGG - Intronic
922151315 1:223007249-223007271 AAATGCTGTCAGAAGCAGGAAGG + Intergenic
922628124 1:227073755-227073777 GCTTGCTTTTAGAAAAATGATGG - Intronic
922919474 1:229289881-229289903 CAATGCTTCCAGAAAAATGATGG - Intronic
922974503 1:229772574-229772596 AAATCCTTTTAAAAGAAAAAAGG - Intergenic
923285488 1:232490778-232490800 AAATGATCTTACAAGAAAGATGG + Intronic
924306584 1:242695682-242695704 GAATGCATTTTGAAAAATGAAGG - Intergenic
924559756 1:245148122-245148144 AAATGCTCATAAAAGAATAATGG - Intergenic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1063280359 10:4622413-4622435 AAATGCTTTTAGAAGTAGGAAGG - Intergenic
1063307490 10:4918475-4918497 AGATGCTTTTATATAAATGAGGG - Intergenic
1064466757 10:15590749-15590771 ACATGCTTTTGGTAAAATGAAGG + Intronic
1064718553 10:18203811-18203833 AAATGCTATTATAAGAACTACGG - Intronic
1065990473 10:31004529-31004551 AAAAGGTTTGAGAAGAATGAAGG + Intronic
1066194698 10:33087848-33087870 AAATGCCATTTGAAGAAAGATGG - Intergenic
1066429612 10:35338526-35338548 AAAGGCATCTAGAAGGATGAAGG + Intronic
1066702490 10:38144951-38144973 CAATGCATTTAGTAAAATGATGG + Intergenic
1066989978 10:42503762-42503784 CAATGCATTTAGTAAAATGATGG - Intergenic
1067152334 10:43746979-43747001 AAATGATTTTAGGAGAGGGAAGG + Intergenic
1067700027 10:48564743-48564765 AAATGCTTGCAGAAGAGAGAGGG - Intronic
1068108937 10:52655470-52655492 AAATGCTTTAGGAAGACTGGTGG + Intergenic
1068196462 10:53723827-53723849 AAATGCTCTAAGAAAAAAGAAGG - Intergenic
1068321566 10:55424719-55424741 AAATGCTTATATAAGAAAAAAGG + Intronic
1068386630 10:56337356-56337378 AAATTCCATTAGCAGAATGAGGG - Intergenic
1068432721 10:56953536-56953558 AACTGCTTTTAAAAGATGGAAGG + Intergenic
1069018590 10:63460592-63460614 AAATGCTTATGGAATAATAAAGG - Intronic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1071153555 10:82664114-82664136 AATTCCTTTTAGAAGCATGGGGG - Intronic
1071250833 10:83817837-83817859 AATTGCTTTTACATGAATGGAGG + Intergenic
1071548978 10:86551509-86551531 AAATGCATTAAGAATAATTAGGG - Intergenic
1072906574 10:99459448-99459470 AAGAGCTTTTAAAAAAATGATGG + Intergenic
1073047392 10:100647783-100647805 GAATGTTTTAAGAATAATGATGG - Intergenic
1073182617 10:101594213-101594235 AAATGCTTTTAAAAGTATCATGG + Intronic
1073211923 10:101811083-101811105 AAATGCTTTCTTAAGAATCAGGG + Intronic
1073536587 10:104282110-104282132 GAATACTTTTAAAAGCATGAAGG - Intronic
1073867643 10:107823526-107823548 TCATTCTTTTAGAAAAATGAGGG - Intergenic
1074284653 10:112086707-112086729 AAATGCCTTTAAAATACTGAGGG + Intergenic
1074349669 10:112724024-112724046 AAATGCTTGTAGGAGAAAAAGGG - Intronic
1074838028 10:117317957-117317979 AAATTATTTTGGAAGAAAGAGGG - Intronic
1075912196 10:126134210-126134232 AAATGCTTTTAAAAAAATGCAGG + Intronic
1076946899 10:133657721-133657743 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1077756886 11:5040585-5040607 ACATGCTTTCCAAAGAATGAGGG - Intergenic
1078179174 11:8996247-8996269 AAAGGCTTTTTGAAGAAAGAAGG - Intronic
1078407716 11:11085844-11085866 AAATGCTAGTAGAAGATTGCTGG + Intergenic
1079396237 11:20066367-20066389 AAATGCTTTCAGGAGAAGGTTGG - Intronic
1080176274 11:29366650-29366672 TACTGCTTTTAGAAGATTGTAGG - Intergenic
1080448035 11:32355018-32355040 GGATGATTTTAGAAGAAGGAAGG - Intergenic
1081035485 11:38139314-38139336 AAATGCTATTTGAATTATGATGG - Intergenic
1081221141 11:40463774-40463796 AAAGGCTTTAAGAAGACTTATGG + Intronic
1083098790 11:60281546-60281568 GGATGGTTTTAGAAGGATGATGG - Intronic
1083459115 11:62799203-62799225 AAAAGCATCTAGAAAAATGAGGG + Intronic
1085535940 11:77217608-77217630 AAATTAGTTTAGAAAAATGAGGG + Intronic
1085695020 11:78696887-78696909 AAATCCTTTCAGCTGAATGAGGG - Intronic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086229156 11:84547713-84547735 ACATGCTTTGAGAAAAAAGAGGG - Intronic
1086241454 11:84697698-84697720 AAATGATTTTGGAAAAATAAAGG - Intronic
1086815862 11:91369789-91369811 AAATGCTGTAAGAAAAGTGATGG - Intergenic
1086994303 11:93339123-93339145 AATTGCTTTTAGAGGAAACAGGG - Intronic
1087515977 11:99161672-99161694 AAATGGCTTTAGAAAAATTAAGG - Intronic
1087818897 11:102689227-102689249 TAATGTTTTTAAAAAAATGAGGG + Intergenic
1087882959 11:103440487-103440509 AAATTCTGTCATAAGAATGAAGG - Intronic
1088069802 11:105768254-105768276 AAATGCATTTAGAAGAAAACTGG - Intronic
1088340099 11:108755249-108755271 AAATGCTTTTATTAGCAGGAAGG - Intronic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090677643 11:129016404-129016426 AAAAGTTTTTAGAAGAAATAGGG - Intronic
1090743283 11:129686413-129686435 AAATGATCTTTCAAGAATGAAGG + Intergenic
1093833834 12:23801356-23801378 AAATGGGTTTGGAAGATTGAAGG - Intronic
1095341703 12:41097501-41097523 AAATTCTTTTAGAAAATAGAAGG - Intergenic
1095586706 12:43857980-43858002 AAACGCTGTTAGAAGATTTAGGG + Intronic
1095903404 12:47352398-47352420 AGATGCTATTTGAAGAAAGAAGG + Intergenic
1098116386 12:67182972-67182994 AAATGATCTTTCAAGAATGAAGG - Intergenic
1098321268 12:69246102-69246124 AATTACTTTTAAAAGAATGGAGG + Intronic
1098554887 12:71807300-71807322 AAATGCTTTCAGAAAATTCATGG - Intergenic
1098640510 12:72833238-72833260 AAATGCTTTAAGAAAATAGAAGG - Intergenic
1099074227 12:78084713-78084735 AAACAGTTTTAGAAGAGTGATGG - Intronic
1099367715 12:81789998-81790020 AAATCATTTTAGATGAATGATGG - Intergenic
1099541775 12:83918682-83918704 AAATGCTTTTAGAATAATAAAGG + Intergenic
1099845945 12:88029009-88029031 TAATCTTTTTAGTAGAATGAAGG - Intronic
1100230978 12:92607192-92607214 AAAAGCTCTTTCAAGAATGAAGG + Intergenic
1100629674 12:96375256-96375278 AAATGTGTTTAGGATAATGAAGG - Intronic
1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG + Intergenic
1100782797 12:98047258-98047280 ATATGCTTCTTAAAGAATGAGGG - Intergenic
1101188071 12:102302417-102302439 AAAATCTTTTAGAAGAAGAAAGG + Intergenic
1101408051 12:104446179-104446201 AAATGCATTTAGAAAAACAAAGG + Intergenic
1101453995 12:104810329-104810351 AATAGCTTTTAAAAGAATGAGGG + Intronic
1106124070 13:26885750-26885772 AAAGGCTTCTAGAAGAATCAGGG - Intergenic
1106364999 13:29069989-29070011 ATATGGTTTTGGAATAATGAAGG - Intronic
1107366803 13:39687949-39687971 AAAGTCTATTAGCAGAATGAGGG - Intronic
1108194394 13:47977641-47977663 ACATGCTATTAACAGAATGAAGG + Intronic
1108284925 13:48897386-48897408 AAATCCTTTTTGAACAAGGAAGG - Intergenic
1108998109 13:56761052-56761074 AAAAGTTTTTAAAAAAATGAAGG + Intergenic
1109756494 13:66767818-66767840 AAATGTTTCTGGAAGAAAGAGGG - Intronic
1109868317 13:68296531-68296553 AAATGCTCTCAGAAAAATGGAGG + Intergenic
1110422399 13:75327380-75327402 AAATGATTTTTAAAAAATGAGGG + Intronic
1110461929 13:75754761-75754783 AAATGCTTTTGGAAGGAAAATGG + Intronic
1110771139 13:79348039-79348061 AATTGATGTTAGTAGAATGAGGG - Intronic
1111434034 13:88183276-88183298 AAATCCTCTAAGAAAAATGAGGG - Intergenic
1111500227 13:89109231-89109253 TTATCCTTTTAGAAGAAAGAGGG - Intergenic
1113533852 13:111049001-111049023 AAATCCTTTCAAAAGAAAGAAGG + Intergenic
1114322620 14:21559768-21559790 AAATTTTTTTAAAAGAAAGAGGG + Intergenic
1114430270 14:22654849-22654871 AAAGGAGTTTAGAAGAAGGAGGG + Intergenic
1116453917 14:45095849-45095871 AATTGCGTTTAGAAGAAAAAGGG + Intronic
1116558361 14:46343152-46343174 AAATGCTCATAAAAGGATGAGGG - Intergenic
1116762891 14:49036646-49036668 AAATGCATTTAACATAATGAAGG + Intergenic
1116991589 14:51283104-51283126 AATTCATTTTAGAAGAATAATGG - Intergenic
1117419464 14:55530094-55530116 AAATGATTTTTCAAGAATGAAGG + Intergenic
1119081078 14:71694284-71694306 GACTGCTTCTGGAAGAATGAAGG + Intronic
1119160605 14:72449401-72449423 GAATGCTTTGGGAAGAATCAGGG + Intronic
1119206755 14:72800160-72800182 AAATGCTTTTGAAATAAGGATGG + Intronic
1120633395 14:86920372-86920394 AATTGCTTTTTAAAGAAAGATGG - Intronic
1120764324 14:88314795-88314817 CAAAGCTCTTAGAAGAATGCCGG - Intronic
1121597124 14:95172663-95172685 AGATGTTTGTTGAAGAATGAAGG - Intergenic
1202920973 14_KI270723v1_random:30277-30299 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1202923944 14_KI270724v1_random:7304-7326 AAATTTTATTAGAAGAAAGAGGG + Intergenic
1123568391 15:21576071-21576093 ATATATTTTTAGAAGAATGTAGG - Intergenic
1123604499 15:22011393-22011415 ATATATTTTTAGAAGAATGTAGG - Intergenic
1124507976 15:30295286-30295308 AAATGCTTTTAGCAAAACAATGG + Intergenic
1124735579 15:32243371-32243393 AAATGCTTTTAGCAAAACAATGG - Intergenic
1124967690 15:34448890-34448912 AAATGCTGATAGAATAAAGAAGG + Intergenic
1126911431 15:53421266-53421288 AAATGCTTTTAGGAGGAGGTAGG - Intergenic
1126934666 15:53693542-53693564 AAAAGTTTTTAGAAGAAAAAAGG - Intronic
1127042139 15:54988804-54988826 AAATGCTCTGAGAAAAAGGAGGG - Intergenic
1127401482 15:58590811-58590833 AAATCATTTTGGAAAAATGAAGG - Exonic
1128527063 15:68419668-68419690 AAGGGCTTTTAGAAACATGAAGG + Intronic
1128533761 15:68474196-68474218 AAACCCTTTTAGATGAATGTAGG + Intergenic
1129858322 15:78840952-78840974 AAATGCTTTGAGAGGCAAGAAGG - Intronic
1131818164 15:96244555-96244577 AATAGCTATTAGATGAATGAGGG - Intergenic
1131869668 15:96749607-96749629 AAAGGCTTATAGAATAATTATGG - Intergenic
1132267692 15:100489707-100489729 AAAAGGATTTAGATGAATGATGG + Intronic
1133498468 16:6342681-6342703 AAAAGCATTTAGAGGAATAAAGG - Intronic
1133511645 16:6463968-6463990 AAATGCTGTTACCAGAAAGAGGG + Intronic
1133891604 16:9884605-9884627 AAATGCTTTGAGAATAATTCTGG - Intronic
1135221392 16:20617108-20617130 ACACGCTTTTCTAAGAATGACGG + Intronic
1135228224 16:20680338-20680360 AAATGCTTATAGAATGATTATGG - Intronic
1137747628 16:50834769-50834791 AAATACTCTTAGAAGAGTGCTGG + Intergenic
1138156349 16:54708449-54708471 AAATACTTTTCTAAGGATGAAGG + Intergenic
1139008482 16:62603204-62603226 AAATGCTTTGATAAGACCGATGG - Intergenic
1139159782 16:64490497-64490519 AAATGCCATCAGAAGAAAGAGGG + Intergenic
1139229986 16:65274271-65274293 AAATAACTTAAGAAGAATGAGGG + Intergenic
1140223541 16:73061038-73061060 AAATACATTTAGAAAAATCAGGG + Intergenic
1140634966 16:76901655-76901677 AAATGCGTTTAGCAGATAGAAGG + Intergenic
1140727193 16:77824165-77824187 AGGTGGTTTCAGAAGAATGAAGG + Intronic
1141734988 16:85846392-85846414 AAATATTTGTAGAAGAAAGAGGG - Intergenic
1142316153 16:89346623-89346645 AAATGCATTTCTAAGGATGAGGG + Intronic
1142638466 17:1271618-1271640 CGATGCTTTTAGGAGAGTGAGGG + Intergenic
1144288501 17:13803113-13803135 AAATACTTTTAATAAAATGAAGG - Intergenic
1145070159 17:19798518-19798540 TTCTGTTTTTAGAAGAATGATGG - Intronic
1146326582 17:31891369-31891391 GAATGCTCTTAGCAGAATGGAGG - Intronic
1148141547 17:45332789-45332811 AGAAGTTTCTAGAAGAATGAAGG - Intergenic
1148375505 17:47141274-47141296 AAATGCTTTGGGAAGAACTAAGG + Intronic
1149147363 17:53511805-53511827 AAATGTTGATAAAAGAATGATGG + Intergenic
1149332663 17:55602576-55602598 AAATGCCTTTATAAGAATGCCGG - Intergenic
1150420256 17:65027747-65027769 AAAGGCTTTCCTAAGAATGATGG + Intronic
1150912039 17:69398546-69398568 ATATGCTGTTGGAAAAATGATGG - Intergenic
1153196126 18:2598446-2598468 ATAAGCATTTAGAAGAATTAGGG + Intronic
1153389609 18:4539744-4539766 CAAAGCTTTTAGAAGAATATAGG + Intergenic
1153780926 18:8494479-8494501 AAAGGCTATTAGTAGAAAGATGG + Intergenic
1155738329 18:29252549-29252571 AAGGTCTTTTAGAAGATTGAAGG + Intergenic
1155774665 18:29745463-29745485 AACAGCTTTTAGAAGAATTTTGG + Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156396681 18:36705479-36705501 AAATACTTTTGTAAGAGTGATGG - Intronic
1156505437 18:37587579-37587601 AAATGCTTTTCTGAGGATGAGGG + Intergenic
1156674189 18:39507735-39507757 AAATAATTTTAGAAAACTGAGGG - Intergenic
1158255013 18:55536821-55536843 AAGTACTTTTAAAAGTATGATGG - Intronic
1158528174 18:58234224-58234246 AAATATTTTTAAAAGAAAGAAGG - Intronic
1161896999 19:7089919-7089941 ATATGATATAAGAAGAATGAAGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925051465 2:819024-819046 AAATGCTTTAAAAAAACTGAAGG + Intergenic
925599511 2:5593441-5593463 GAATGCATTTTCAAGAATGAAGG + Intergenic
926272482 2:11377181-11377203 AAATTTTTTTAGAAAAATGAAGG + Intergenic
926673092 2:15593280-15593302 AAATCGTTTTAGGAGAATGTTGG - Intronic
926984104 2:18602690-18602712 AAATGTTTTTGAAGGAATGAAGG + Intergenic
927002535 2:18813110-18813132 AAATGATTTTAGAAGGATGAGGG + Intergenic
927418421 2:22903815-22903837 AACTGCTCTTAGAAGAATCCTGG + Intergenic
928385511 2:30864318-30864340 AAAACAATTTAGAAGAATGAAGG + Intergenic
928431735 2:31225132-31225154 AAATGCTTTTAGAAAAATAAGGG + Intronic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
929322467 2:40561220-40561242 AAATGTTTTCAGAGGAAAGATGG - Intronic
929328329 2:40646363-40646385 AATTACTTTTTGAAGAAAGAAGG + Intergenic
929339739 2:40800755-40800777 AAATGGTGGTAGAATAATGAAGG - Intergenic
930163407 2:48180504-48180526 AAATTTTTTTAAAAGTATGATGG + Intergenic
930759319 2:55015443-55015465 AAAATCTTTTAGAAAACTGAGGG + Intronic
931477295 2:62602028-62602050 AAATGCTTTTAAATGAATGACGG - Intergenic
931754567 2:65361052-65361074 AAATTCTTTTAAAAGAAAAAAGG + Intronic
932234025 2:70106812-70106834 AAAAGTTTTTAAATGAATGAAGG + Intergenic
932639020 2:73423308-73423330 AAATGCTTTTTGCAGAATAAGGG - Intronic
933044448 2:77518288-77518310 AAATGCTTTTAGGAGGATCATGG + Intronic
933146446 2:78859689-78859711 AAATGATTTTAAAAAAGTGAGGG + Intergenic
935918181 2:107981578-107981600 AAATGCAGTCATAAGAATGATGG - Intergenic
936551836 2:113450184-113450206 AAATGTTCTTAGAAGAACTAAGG - Intronic
936634659 2:114242002-114242024 AAACTCTTTGTGAAGAATGAAGG + Intergenic
936856107 2:116959001-116959023 CAATGCATTTAGAAGAAAGTTGG - Intergenic
937484172 2:122296812-122296834 AAATGCTATCAGGAGAATCAAGG - Intergenic
937636167 2:124157572-124157594 AATTCTTTTTAGAAGAAAGAAGG + Intronic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
938639169 2:133262468-133262490 AAGTGCTTTAAGAAGCATGTCGG - Intronic
939169419 2:138677067-138677089 ACATGCTGTGAGAAGAATGTAGG + Intronic
940031751 2:149271145-149271167 AAAAACTTTTAGAAGAAACATGG - Intergenic
940096993 2:149988256-149988278 AGTTGCTTTTGGAATAATGAAGG + Intergenic
940451246 2:153840658-153840680 AGATGCTTTTATAAGCATCAGGG - Intergenic
940722963 2:157301706-157301728 CACTGCTTTCAGAAGAAAGAAGG - Intronic
941423299 2:165310941-165310963 AAATGTGTTAAGAAGACTGAGGG + Intronic
941501753 2:166287351-166287373 AAAATCTTTTAGAATAATGATGG - Intronic
943167927 2:184355369-184355391 AAATGCTTTTAAGACAATTAAGG - Intergenic
944032605 2:195254758-195254780 AAATGATTTTAAAAGACTCAAGG + Intergenic
944403341 2:199353738-199353760 AAATTATTTTAAAAGAAAGAAGG - Intronic
944453596 2:199870638-199870660 AAATGTCTTCTGAAGAATGAAGG - Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
945090894 2:206174620-206174642 AAATGCTTTTAGAAAATTCTGGG - Intergenic
945291869 2:208134920-208134942 CAATTCTTCTAGAAGCATGAAGG - Intergenic
946194707 2:218026163-218026185 AAATGCTTTTAGGACAGTGGAGG + Intergenic
946461411 2:219872134-219872156 AATTGATTTTAAAAGAATCACGG - Intergenic
946658050 2:221970103-221970125 TACAGCTTATAGAAGAATGAAGG - Intergenic
946818255 2:223602907-223602929 ATATGATTTTAAAAGAATGATGG - Intergenic
947080062 2:226386114-226386136 AAGTGCTTATAGAAGATTTAAGG - Intergenic
947584787 2:231347882-231347904 AAATGCTTACAGAAAAATAAAGG - Intronic
947956743 2:234198767-234198789 AAATGCTTTTTTAAGAATAATGG + Intergenic
948405589 2:237716112-237716134 ATATGTTTTTAGAAGGATGGGGG - Intronic
1168732106 20:93526-93548 CCATGCTTTTAGTAGTATGAAGG - Intronic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1169014179 20:2278556-2278578 AAATGGTCTTAGAGGAAGGAAGG + Intergenic
1169410918 20:5369639-5369661 AAATGACTTTATAAAAATGAAGG + Intergenic
1169434053 20:5569130-5569152 AAATGGTATTAGGAGAAAGAAGG - Intronic
1169951828 20:11053059-11053081 AAATACTTTTATCAGAATTAAGG + Intergenic
1169981630 20:11391290-11391312 AAGTGCTATTGGAACAATGAGGG + Intergenic
1170075420 20:12413547-12413569 AAAGACTTTGAGAACAATGAAGG - Intergenic
1171111576 20:22488542-22488564 GAATACTTTTATAACAATGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171723428 20:28591205-28591227 AAATGCTTATATTAGAAAGAGGG + Intergenic
1171754632 20:29091886-29091908 AAATGCTTATATTAGAAAGAGGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171859917 20:30388745-30388767 AAATGCTTATATTAGAAAGAGGG - Intronic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172822846 20:37753623-37753645 AGAGGCTTTTGGAAAAATGAAGG + Intronic
1173548972 20:43919175-43919197 AAATATTTTTGGTAGAATGATGG - Intronic
1175025638 20:55899539-55899561 ACATGCTTTTGGAAAAATCAGGG + Intergenic
1177099040 21:16876936-16876958 AAATGCTTTTATTAAAAAGAAGG + Intergenic
1177371061 21:20204267-20204289 AAATGTTTAAAGAAGTATGAAGG - Intergenic
1178272505 21:31204769-31204791 ATGTGCTTTTACAAGAATGCAGG - Intronic
1179144338 21:38754082-38754104 AAATGCTTTTAGAGTATAGAAGG - Intergenic
1179523054 21:41957819-41957841 AAATTCTTTTAGAAAAATGTGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180296984 22:10949861-10949883 AAATGCTTATATTAGAAAGAGGG + Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
1184107700 22:42377943-42377965 AAATGTTGTTAAAAGAATGAAGG + Intergenic
1184440588 22:44510537-44510559 AAAAGTTTTTAGAAAAATGCTGG - Intergenic
1185184397 22:49389020-49389042 AAATTCTTTTATAAGAAGGGTGG - Intergenic
949256400 3:2051696-2051718 AAATGCTCTTAAGAAAATGAAGG + Intergenic
949421855 3:3874090-3874112 AAAGGCTTTCAGAGGAAAGAGGG - Intronic
949896418 3:8770146-8770168 AAATGATTTTAGAATAGAGAAGG - Intronic
951239835 3:20274782-20274804 AAGTACTTTTAGAATCATGAAGG + Intergenic
951696451 3:25450105-25450127 AAATGCTTAGAGTAGAGTGAAGG + Intronic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
953495824 3:43386273-43386295 AAATACTTTAAAAAGAAGGAAGG + Intronic
954828426 3:53396656-53396678 AAATGCTTTTACACTATTGATGG + Intergenic
955425244 3:58782163-58782185 AAATGATCTATGAAGAATGAAGG + Intronic
956312220 3:67893918-67893940 AAATACTTCAAGAAGATTGATGG - Intergenic
956526612 3:70170108-70170130 AAATGGTTTTAGAAGACTACCGG + Intergenic
957080560 3:75632695-75632717 AAATTTTATTAGAAGAAAGAGGG + Intergenic
957782812 3:84841706-84841728 AAATGCTCTAAGAAGAGTCAGGG - Intergenic
958134645 3:89472631-89472653 AAATTCATTAAGAAGAATGAAGG + Intronic
958168279 3:89905699-89905721 AAATGTTTCTACAAGAATCATGG - Intergenic
959394266 3:105817054-105817076 ACATGTTTTTAGAATTATGAAGG + Intronic
959640830 3:108631678-108631700 AAATGCTTTTAAAAAATTGGAGG - Intronic
960036172 3:113104992-113105014 AAAGGCTGTTTGAAGAAGGAAGG + Intergenic
960247794 3:115418559-115418581 AGATGCTTATAGAAAAATGTAGG - Intergenic
960467488 3:118015023-118015045 AAATGATCTTATGAGAATGAGGG - Intergenic
960527090 3:118722582-118722604 AAATGGGTTTAGAACAATTAGGG - Intergenic
962773362 3:138634447-138634469 AAAAGGTGTTAGAAGAAAGAAGG - Intergenic
962925328 3:139988065-139988087 AGATGCTTTTAGAAACATGCAGG - Intronic
963664109 3:148160397-148160419 ACATGCTTTTGGAAAAATGGTGG - Intergenic
964045260 3:152316177-152316199 ATATGAATTTTGAAGAATGAGGG + Intronic
964617003 3:158677003-158677025 ATATGCTATTAGAAAAATGGAGG - Intronic
964698330 3:159535292-159535314 ATATACCTGTAGAAGAATGATGG - Intronic
966077049 3:175949149-175949171 AAATGTTTTTAAAGAAATGATGG + Intergenic
966302622 3:178496322-178496344 ATATGCTGTTAGAAGAAGCAAGG - Intronic
966486350 3:180475359-180475381 AAATGCTTTTTGAAGCCTGGAGG - Intergenic
966812592 3:183860753-183860775 AAATGCTTTGAAAATAGTGAAGG + Intronic
968348444 3:198031592-198031614 AAATGCTTTCAGAATTCTGATGG - Intronic
968862864 4:3186464-3186486 AAATGCTTTTAAATGAGGGAAGG + Intronic
970072375 4:12175890-12175912 TAATACTTGTTGAAGAATGAAGG + Intergenic
970400665 4:15714300-15714322 AAATGTTTATACTAGAATGAAGG - Intronic
970726585 4:19052670-19052692 AAATATTATTTGAAGAATGAGGG - Intergenic
972220439 4:36948955-36948977 AAATGCTTTTACATGGTTGATGG - Intergenic
973161889 4:47030013-47030035 AAATTCAAATAGAAGAATGAGGG - Intronic
973306176 4:48653241-48653263 AACTTCAATTAGAAGAATGAGGG + Intronic
973849333 4:54945716-54945738 CGATGCTTTTAGTAGAATCACGG - Intergenic
973898249 4:55438533-55438555 AAAATCTGTTAGAAGAAAGAAGG + Exonic
973971647 4:56218813-56218835 AAAGGCTTTTAGATGATTGCAGG + Intronic
974500690 4:62697726-62697748 AAAAGTTTTTATAACAATGATGG - Intergenic
974625880 4:64428754-64428776 AAATGCTTTTAGAAGCAGCCAGG - Intergenic
974707487 4:65540021-65540043 ACATCCTTGTAGAAGAATCATGG - Intronic
975454664 4:74576032-74576054 AAATACTTTTCTAAGCATGAGGG - Intergenic
975838521 4:78450069-78450091 AAATGATTTTAGGAGACTGGAGG - Intronic
975963868 4:79945363-79945385 AAATGATGTAAGATGAATGATGG - Intronic
976534977 4:86202297-86202319 AAGTGCTGTGAGAAGACTGAGGG - Intronic
977778675 4:100954383-100954405 AAAAACTATTAGAAGAATGCTGG - Intergenic
977923538 4:102672423-102672445 AAATGTTTTTCCAAGACTGAAGG - Intronic
979027889 4:115599843-115599865 AAATGCTTTCTGAAAAATAAAGG + Intergenic
979056755 4:116004758-116004780 AAATGCTATTAAAAGAATGTTGG + Intergenic
979116157 4:116826946-116826968 AAATGCTTCCAGAATAATGCAGG + Intergenic
979141561 4:117182551-117182573 AAATGCCCATAGGAGAATGAGGG - Intergenic
979859087 4:125671422-125671444 ACTTTCTTTTAGAAGAATTAAGG + Intergenic
980063200 4:128154340-128154362 GAAGGATTTTAGAAGGATGAAGG - Intronic
980785036 4:137542349-137542371 AATTGCTTTTATAATAATGAGGG + Intergenic
980785885 4:137554309-137554331 AAATGCAGTTAGAGGAATAAAGG - Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981515602 4:145605689-145605711 AAATCGTTTTTTAAGAATGAGGG - Intergenic
981761245 4:148197619-148197641 AAATCCTTTTAGAACAATCCTGG - Intronic
981780332 4:148422235-148422257 GAATGCTTTTAGAAGTTTCAGGG + Intronic
982648135 4:158049709-158049731 GAATACTTTTAGAAAAATGATGG - Intergenic
982764189 4:159324592-159324614 AATTGATTTTAGAAGAGTCATGG + Intronic
983066574 4:163216994-163217016 CTATGGTTTTAGAAGAAGGAAGG - Intergenic
983284132 4:165717558-165717580 AAATGTTTTTAAAAGCATCATGG - Intergenic
983790986 4:171796609-171796631 AAATGCATTTATAAGATTAATGG + Intergenic
984039523 4:174713529-174713551 AAATGTGATTAGAATAATGATGG - Intronic
984189053 4:176582852-176582874 AAATGCTTTTTGACTTATGACGG - Intergenic
985009244 4:185565833-185565855 AGAGGCTTCTAGAAGACTGAGGG + Intergenic
985438079 4:189952455-189952477 AAATGCTTATATTAGAAAGAGGG - Intronic
985450356 4:190058520-190058542 AAATTTTATTAGAAGAAAGAGGG - Intergenic
986300444 5:6474510-6474532 AAATGATTGATGAAGAATGAAGG - Intronic
986906380 5:12498770-12498792 AAATAGTTTTAGAAAATTGAAGG + Intergenic
987070556 5:14333473-14333495 AAATGTAATCAGAAGAATGATGG - Intronic
987378175 5:17257463-17257485 AAATGGTTTTAGGTAAATGAAGG + Intronic
987589518 5:19905563-19905585 CAATTCTTTTTGATGAATGAAGG - Intronic
988141840 5:27253256-27253278 CAATGTTTGTGGAAGAATGAGGG - Intergenic
988383757 5:30535034-30535056 AAATTCTTTTATGAGAGTGATGG + Intergenic
988406789 5:30834459-30834481 GAATGCTTTTACAAGGTTGATGG + Intergenic
988711083 5:33775602-33775624 AAATACTTTTATAAGAACTAAGG + Intronic
988946849 5:36212150-36212172 AATTGCTTCAAGAAGAATTAAGG - Intronic
989304910 5:39943065-39943087 AAATCTTTTTTGAAGAATGCAGG - Intergenic
990243858 5:53842681-53842703 AAAAGCTTTTAAAGGAATGCTGG - Intergenic
990694013 5:58395115-58395137 ACATGTTGCTAGAAGAATGAAGG + Intergenic
991507862 5:67343562-67343584 ACATGTTTTTAGAAGAATACTGG - Intergenic
992653149 5:78881767-78881789 AAATGCTTTTAAAATCATGTAGG + Intronic
993908890 5:93656270-93656292 AAATGCTTTTAAAAAAATGTAGG + Intronic
993976616 5:94490481-94490503 AAAGGCTATAAAAAGAATGATGG + Intronic
994374150 5:98999360-98999382 AAATGCTTTTAGAAATATGTAGG - Intergenic
994438791 5:99774528-99774550 AAATGCTTTTAGAAAAGGGAGGG - Intergenic
994731418 5:103495905-103495927 AAATGCTTTTATAGTAATCATGG - Intergenic
994753670 5:103768774-103768796 CAATACTTTTAAAAGAATAAAGG - Intergenic
994828707 5:104748265-104748287 AAATGGTTTTACAGGAATAATGG - Intergenic
995068204 5:107886575-107886597 AAAAGCTTTTAAAACAATGGGGG + Intronic
996138931 5:119880480-119880502 AAATGATTAAAGAAGAAAGATGG + Intergenic
996319072 5:122193652-122193674 AAATGACTTTTGAAGAAAGAAGG + Intergenic
996624621 5:125555593-125555615 AAAGGCTCATGGAAGAATGATGG - Intergenic
997002835 5:129783112-129783134 AAATGTATTTATTAGAATGAGGG - Intergenic
999115208 5:149156859-149156881 AAATGTATTTAGAAGAATAAAGG + Intronic
1000114337 5:158139178-158139200 AAATGCTTTTATGAGAATGCTGG + Intergenic
1000836741 5:166164367-166164389 AAATGCTTTTTAAAAGATGAGGG + Intergenic
1000938340 5:167329875-167329897 AAATGCTTTATGAGGAATTAGGG - Intronic
1001150104 5:169219862-169219884 AAAGGCTTTGAGAGCAATGAAGG - Intronic
1003009432 6:2412800-2412822 AAATGCCTTTATAAGATTGCAGG - Intergenic
1003759264 6:9157019-9157041 AAATGGATTTCCAAGAATGAAGG - Intergenic
1004509309 6:16271873-16271895 AAATGCTTTCAGTATAATGTTGG - Intronic
1004891427 6:20104620-20104642 TAATGCTTTTTGAAGAATAAAGG + Intronic
1006420705 6:33932044-33932066 AATTGTCTTTAAAAGAATGAGGG + Intergenic
1006724990 6:36192662-36192684 AAAGGCATTAAGCAGAATGATGG - Intergenic
1007512460 6:42384305-42384327 AAAATGTTTTATAAGAATGAGGG + Intronic
1007982792 6:46176260-46176282 AAAAGCCCTTAGAAGAATGCAGG + Intergenic
1008685005 6:53915622-53915644 AACTGTTTTTACATGAATGAAGG + Intronic
1008841822 6:55911731-55911753 AAATGCTTATATAAGAAGAAAGG + Intergenic
1009290595 6:61876491-61876513 ATATTTTTTTAGAAGAATGTAGG - Intronic
1010420534 6:75669483-75669505 AAATACCTTTAGAAGGATAATGG + Intronic
1010487751 6:76435579-76435601 AAATTCTTATAGTAAAATGATGG - Intergenic
1010546687 6:77166749-77166771 AAATGCTTTCAAAAAAATCAAGG - Intergenic
1010632449 6:78214568-78214590 AAACTCTTTAAGAAGAATCAAGG - Intergenic
1010959901 6:82133929-82133951 AAATGGGATTGGAAGAATGACGG - Intergenic
1011721682 6:90163526-90163548 TAATGCTTTTTGAAAAATCAGGG - Intronic
1011724976 6:90201722-90201744 AAATGATCTTAGAATAAAGAAGG - Intronic
1011899334 6:92272684-92272706 AAATGCTTTGAGAATAAAGGGGG - Intergenic
1012029458 6:94039149-94039171 AATTGCTCTTAGAAGAATAGAGG + Intergenic
1012175835 6:96082643-96082665 AAATGCATATAGAAGAATAAAGG - Intronic
1012327901 6:97946319-97946341 GAATGATTTTAGTAGAGTGATGG + Intergenic
1012362186 6:98396205-98396227 CAATATTTTTAAAAGAATGAAGG + Intergenic
1012690330 6:102302526-102302548 AATTACTTTCAGAAGAAGGAAGG + Intergenic
1012813089 6:103985802-103985824 AAATGCTCTGAGAAAAAGGAGGG + Intergenic
1013434235 6:110085684-110085706 AAATTCATTTGGAAGAATAAAGG + Intergenic
1013893140 6:115050245-115050267 ATATGTTTTTAGAAGCAAGATGG + Intergenic
1014075270 6:117228218-117228240 CAATGCCTTTAGGAGAGTGAGGG - Intergenic
1014471915 6:121826437-121826459 CAATACTTTTAAAAGAAAGAGGG + Intergenic
1014476442 6:121878254-121878276 AAAGCCTCTTAGAAGAATAATGG + Intergenic
1014489919 6:122049936-122049958 AAATGTCTTTTGAAGAATAATGG - Intergenic
1014923825 6:127246960-127246982 AATTGCTTTTCCAAGAATAATGG + Intergenic
1015630151 6:135223731-135223753 AAATCCTTTAGGAAGAATGATGG - Intergenic
1015867918 6:137746294-137746316 AAATGTTTTTAGAAGTCAGAAGG + Intergenic
1017069962 6:150567121-150567143 AAATGTTTTCAGAAGAAAAAGGG - Intergenic
1017363990 6:153611051-153611073 AAATGACTTTAGAAGTAAGAAGG - Intergenic
1018069258 6:160147661-160147683 AAAAGCTATTAGAAGAATGAGGG + Intronic
1018845132 6:167550774-167550796 AACTGCTTTTAAAAAAAAGAGGG + Intergenic
1019694462 7:2437443-2437465 AGATGCTTTAAGAGGAAAGAGGG - Intergenic
1019878050 7:3833160-3833182 AGAAGCTCTTAAAAGAATGAAGG + Intronic
1020063866 7:5172620-5172642 AAATGCATTTTTAAAAATGATGG + Intergenic
1020406813 7:7844849-7844871 AAATCTTTTTAGAAGCATAAAGG - Intronic
1020863184 7:13520907-13520929 AAATGTTTGTAGCAGAGTGATGG + Intergenic
1020921913 7:14276444-14276466 AAATGTTTTTAAAAATATGATGG - Intronic
1021134860 7:16953029-16953051 AAATGTTTTTTGAAAAATGCAGG - Intergenic
1021160114 7:17262646-17262668 AAATCCTTTTAGAATCATCAAGG + Intergenic
1022432959 7:30345308-30345330 AAAAGCTATTACAAAAATGAAGG - Intronic
1022630305 7:32078437-32078459 AAATGCTTCTTGAAGAAAGGAGG + Intronic
1023003928 7:35842062-35842084 AAATGCTTTCAACAGAAAGATGG - Intronic
1024111459 7:46151139-46151161 AAAGGCATTTAAAAGAATTATGG + Intergenic
1024135775 7:46406570-46406592 AAATGATATTAGAAGATAGAAGG + Intergenic
1024883934 7:54120497-54120519 AAATTCTGTTAGCAGAATAAAGG + Intergenic
1025866476 7:65386558-65386580 AAATGCTTTTTGAAACAGGATGG + Intronic
1027752870 7:82173329-82173351 AAATGTTTTTAGAAAAATAAAGG + Intronic
1028228640 7:88279304-88279326 GAATGTTTAAAGAAGAATGATGG - Exonic
1028392488 7:90333274-90333296 AAATAATTCTAAAAGAATGATGG - Intergenic
1028450373 7:90975441-90975463 AAATGTTTTTATATGAAGGATGG - Intronic
1028746397 7:94331907-94331929 AAATCTGTTTAGAAGAATAATGG - Intergenic
1030224467 7:107133706-107133728 AAAAACTTTTGGAAGAATGATGG - Intronic
1030507307 7:110441293-110441315 AAATGTTGATAAAAGAATGATGG - Intergenic
1030752070 7:113240912-113240934 AAATGCTTTTAGAAGCAGCCAGG - Intergenic
1032477303 7:132220747-132220769 AGATCCCTTTAGAAGAATGATGG - Intronic
1032590573 7:133188383-133188405 CAATGATTTTAGAAGCAGGAAGG - Intergenic
1032750630 7:134836862-134836884 AATTGTTAATAGAAGAATGAGGG - Intronic
1032849197 7:135778881-135778903 AATGGCTTTTAGAAAAAAGATGG + Intergenic
1033388240 7:140900336-140900358 GAAAGCTTTTAGAAAAATAAAGG - Intronic
1033768858 7:144525746-144525768 TAAAGCAATTAGAAGAATGAAGG - Intronic
1033937697 7:146607782-146607804 AAGTGATTTAAGAAGAAAGATGG - Intronic
1034143539 7:148847295-148847317 CATTGCTTTTAGAATAATCATGG - Exonic
1034325491 7:150227448-150227470 AGATACTTTTAAAAGAATCATGG - Intergenic
1034719241 7:153273414-153273436 AAATACTATGAGAAGAATTATGG + Intergenic
1034767708 7:153741802-153741824 AGATACTTTTAAAAGAATCATGG + Intergenic
1035401983 7:158571717-158571739 AGGTGCTTTTTGAAGAATCAGGG - Intronic
1035442381 7:158912386-158912408 AAATCCTTTTAAAAGGAGGAAGG + Intronic
1035598193 8:878250-878272 AAATTCTTTTAGGAGAATACGGG + Intergenic
1037017736 8:13929382-13929404 AAATGCTCTGAGAAAAATAAGGG + Intergenic
1037501275 8:19487750-19487772 AAATCCTATTAGAAGATGGATGG - Intronic
1038262490 8:26008607-26008629 AAGTGCAGTTAGAAGAATTAAGG + Intronic
1038544846 8:28417879-28417901 AAATATTTTTAGAAGATTCATGG - Intronic
1038559275 8:28556983-28557005 AAAGGCTTCTAGGAGAATGGTGG + Intronic
1038899989 8:31831401-31831423 AAACCCTTTAAGAAGAATGTGGG - Intronic
1039137438 8:34341468-34341490 AAATATTTTTAGAAGCATGTAGG + Intergenic
1039587482 8:38719356-38719378 AAAGGGTTTTATAAGGATGAAGG - Intergenic
1040042502 8:42930808-42930830 AGATGATATTAGAAGAAAGAAGG - Intronic
1040619569 8:49075716-49075738 CAATTTTTTTAAAAGAATGAAGG + Intronic
1041597238 8:59669040-59669062 AACTGCTTTTGGGAGAATTAAGG + Intergenic
1041711727 8:60900520-60900542 AGATGCTTTTAGAAAAACAAAGG + Intergenic
1042849422 8:73201662-73201684 AAATAGTTTTGGACGAATGAAGG - Intergenic
1043378610 8:79678579-79678601 AAGAGCTTTTAGATGAATGTTGG - Intergenic
1043909139 8:85840161-85840183 AAATGCTTCTGAAGGAATGATGG - Intergenic
1043961941 8:86426851-86426873 AAATGCTTATCAAAGAAAGAAGG + Intronic
1044046671 8:87443911-87443933 AGATACTTTTAGATGAATGTTGG + Intronic
1044122719 8:88417759-88417781 TAATGCTTTTAGAACAAAAATGG - Intergenic
1044877435 8:96683703-96683725 AAATGGATTTAAAAGAATGAAGG - Intronic
1045376233 8:101577192-101577214 AAATTCATTTTGAAGCATGAAGG - Intronic
1045479762 8:102582627-102582649 AAATGGTTCTTGAAGAATCAGGG + Intergenic
1045782192 8:105879977-105879999 AAATGTTTTTGTAAGAATCATGG + Intergenic
1046749851 8:117915397-117915419 GCAGGATTTTAGAAGAATGAGGG - Intronic
1047028333 8:120849131-120849153 AGCTCCTTTTAGAAAAATGAAGG - Intergenic
1047108488 8:121761727-121761749 AAATGTTTTTATAAGAAAGAGGG + Intergenic
1047989959 8:130275751-130275773 AAATGCTTTTAAAACAAATAAGG + Intronic
1048637518 8:136313603-136313625 AAATGCTTTTAGAAGAGGTATGG - Intergenic
1049901163 9:166970-166992 AAATGTTCTTAGAAGAACTAAGG + Intronic
1050907425 9:11022808-11022830 AAATTCTTTCACAAGAATGTGGG + Intergenic
1051289629 9:15532023-15532045 ATATGATTTTAAAAGAATGATGG - Intergenic
1052067073 9:24035043-24035065 AAACGCCTGTAGAAAAATGAGGG - Intergenic
1052072293 9:24096385-24096407 AAATGCTTTCAGAAGAAACTTGG + Intergenic
1052111811 9:24594891-24594913 AAATACTTTAAGAAGCATCAAGG - Intergenic
1052529798 9:29667386-29667408 TAATGCTTTTAGAATGAAGAAGG - Intergenic
1052579439 9:30335563-30335585 AAATCCTTTTAGAGCAAAGAAGG - Intergenic
1052715968 9:32117459-32117481 AAATGCTTTAAGAAGAGACAAGG - Intergenic
1052751005 9:32490703-32490725 ATATGCTTTGAGAAGCATAAGGG + Intronic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1053386655 9:37696537-37696559 AATTCCTTTTGGAAGAAGGAGGG - Intronic
1053726674 9:41009173-41009195 AAATGCTTATATTAGAAAGAGGG - Intergenic
1053744202 9:41177283-41177305 AAATGTTCTTAGAAGAACTAAGG + Intronic
1054339267 9:63842635-63842657 AAATGCTTATATTAGAAAGAGGG + Intergenic
1054349481 9:64007184-64007206 AAATGTTCTTAGAAGAACTAAGG + Intergenic
1054483068 9:65687915-65687937 AAATGTTCTTAGAAGAACTAAGG - Intronic
1054684142 9:68253970-68253992 AAATGTTCTTAGAAGAACTAAGG - Intronic
1055412024 9:76040992-76041014 AAATGCTTTTGGAAAACTGATGG - Intronic
1055428661 9:76221138-76221160 AATTGCCTTTTAAAGAATGATGG + Intronic
1056262882 9:84866151-84866173 AAATACTTTTATAACAATAATGG - Intronic
1056466005 9:86855508-86855530 AAATGTATTTAAAACAATGATGG + Intergenic
1056554856 9:87679695-87679717 AAATGCTGGTTGATGAATGAAGG + Intronic
1058174059 9:101717834-101717856 AAATGATTTAGGGAGAATGAAGG + Intronic
1058528491 9:105883577-105883599 AAATGCTTAAAGTAAAATGACGG - Intergenic
1059520656 9:114938442-114938464 CAATGCTTTGAGAAGAAAGAAGG - Intergenic
1059834274 9:118132640-118132662 AAATGCTTTGAGAGGAAATATGG + Intergenic
1059982259 9:119785823-119785845 AAATGGTTTTAAAGGAATAAAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1202803834 9_KI270720v1_random:31060-31082 AAATGCTTATATTAGAAAGAGGG + Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203448637 Un_GL000219v1:88107-88129 AAATGCTTATATTAGAAAGAGGG + Intergenic
1187181232 X:16945980-16946002 AACTGGTTTTGGAGGAATGAAGG + Intergenic
1187290831 X:17951627-17951649 CAACACTTATAGAAGAATGAGGG - Intergenic
1187772246 X:22713052-22713074 AAATGATTTTAAAAGGGTGATGG + Intergenic
1188054297 X:25523672-25523694 AAATGCTTTAAGAAGGATATTGG - Intergenic
1188069834 X:25705282-25705304 GAATGCTTTTAGAATAATCCAGG - Intergenic
1188557912 X:31432620-31432642 AAATGCCTTTATTAGAATAAAGG + Intronic
1188565635 X:31523235-31523257 GAATGCCTTTATAAGAATGATGG + Intronic
1188944648 X:36284116-36284138 AAGTGCTTTTATAAAATTGAAGG + Intronic
1189536014 X:41936140-41936162 AAATGGTTGCAGGAGAATGATGG + Intergenic
1189767170 X:44383709-44383731 AAATGCTTTAACTATAATGAAGG - Intergenic
1190576934 X:51849089-51849111 AAATTCTATTAGAAGAATGTAGG + Intronic
1192710670 X:73581993-73582015 AAATAGTGTTAGAAGACTGAGGG - Intronic
1192722255 X:73711407-73711429 GAATAGGTTTAGAAGAATGAGGG + Intergenic
1192866736 X:75141856-75141878 AAATGCTTGTAAAAAGATGAGGG + Intronic
1193140022 X:78017614-78017636 GAATGCTTTCAGAATAATGTAGG + Intronic
1193634693 X:83934451-83934473 AAATGCTTTGAGAACAATCTAGG + Intergenic
1193782034 X:85714853-85714875 AAATGCTTTTAGAATACTAATGG + Intergenic
1193846050 X:86472225-86472247 AGATCCTTATAGAAGAAAGAGGG + Intronic
1194039045 X:88917030-88917052 AAGGGCTTATAGAAGGATGAAGG - Intergenic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1195003981 X:100669027-100669049 AACTGGTTTCAGTAGAATGAAGG + Intronic
1195479681 X:105329597-105329619 AAATGCATTGTGAAGAATTAAGG + Intronic
1195525603 X:105885927-105885949 AATTTATTTTAAAAGAATGATGG - Intronic
1195578763 X:106478670-106478692 AAATGCTTTCAGAGGAGAGAAGG + Intergenic
1196609704 X:117696735-117696757 AAAAGCTTTTCCAAGAAGGACGG + Intergenic
1196646241 X:118120038-118120060 AAATGCTTTTAGACCGATTAGGG - Intergenic
1197806918 X:130406252-130406274 AAATACTTGTAGAAGAAAGTTGG - Intronic
1198398612 X:136248479-136248501 ACATGCATTTAAATGAATGAGGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198625654 X:138570111-138570133 AAATCCTTTTGGAAGCATAAAGG - Intergenic
1199339126 X:146655672-146655694 AAATATTTTTAAAAGCATGAAGG - Intergenic
1199565242 X:149208874-149208896 ACATGCTTCTAGGAGAAAGAAGG + Intergenic
1200038306 X:153347247-153347269 AAACGGTTTAAGAAGAATGCAGG + Exonic
1200424587 Y:3007210-3007232 ATAAGCTTTTGGAAGGATGAGGG - Intergenic
1201771619 Y:17621773-17621795 AAATTGTATTAGAAGAAAGAGGG - Intergenic
1201829936 Y:18284213-18284235 AAATTGTATTAGAAGAAAGAGGG + Intergenic
1201941205 Y:19462333-19462355 AAAGTCCTTTAGATGAATGATGG - Intergenic
1201983654 Y:19936930-19936952 AAATGCTTTTAAATATATGATGG + Intergenic
1202056019 Y:20830601-20830623 AAATGCTTTTAAATATATGATGG + Intergenic