ID: 915784281

View in Genome Browser
Species Human (GRCh38)
Location 1:158591250-158591272
Sequence AAATATATGGATAAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915784276_915784281 28 Left 915784276 1:158591199-158591221 CCTATGAATTTCTATAGCAAAGT No data
Right 915784281 1:158591250-158591272 AAATATATGGATAAGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915784281 Original CRISPR AAATATATGGATAAGTTTGA GGG Intergenic
No off target data available for this crispr