ID: 915790664

View in Genome Browser
Species Human (GRCh38)
Location 1:158666806-158666828
Sequence ATTTCCTTGAAAAAGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 526}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915790664_915790669 23 Left 915790664 1:158666806-158666828 CCAGACCTCTTTTTCAAGGAAAT 0: 1
1: 0
2: 1
3: 31
4: 526
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191
915790664_915790666 4 Left 915790664 1:158666806-158666828 CCAGACCTCTTTTTCAAGGAAAT 0: 1
1: 0
2: 1
3: 31
4: 526
Right 915790666 1:158666833-158666855 ATCCAAACACTCTATTTTCTAGG 0: 1
1: 0
2: 1
3: 24
4: 222
915790664_915790668 19 Left 915790664 1:158666806-158666828 CCAGACCTCTTTTTCAAGGAAAT 0: 1
1: 0
2: 1
3: 31
4: 526
Right 915790668 1:158666848-158666870 TTTCTAGGAGAAGCATAATGAGG 0: 1
1: 0
2: 1
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915790664 Original CRISPR ATTTCCTTGAAAAAGAGGTC TGG (reversed) Intronic
901147393 1:7075170-7075192 AATTCCTGCAAAAAGTGGTCGGG + Intronic
904989560 1:34580833-34580855 ATTTCTTTTAAAAAGGGGTATGG - Intergenic
905314927 1:37076319-37076341 ATTACCCTGACAAAGAGGGCAGG - Intergenic
906563937 1:46783270-46783292 ATTTATCTGAAAAAGAGTTCAGG - Intronic
908174999 1:61546980-61547002 ATTTACCTGAAAAAGAATTCAGG - Intergenic
908724677 1:67162848-67162870 ATTTCCTTGAAAATGAGCCGGGG - Intronic
909948250 1:81688653-81688675 ATTTACTTGAAAAAGAATTCAGG - Intronic
910077718 1:83299682-83299704 ATTTACCTGAAAAAGAATTCAGG + Intergenic
910738875 1:90494008-90494030 ATTTACCTGAAAAAGAATTCAGG - Intergenic
912348639 1:108990064-108990086 CTTTTCTTGAAAATCAGGTCAGG + Intronic
912616036 1:111101424-111101446 ATTTACCTGAAAAAGAATTCAGG - Intergenic
913143238 1:115962564-115962586 ATTTACCTGAAAAAGAATTCAGG + Intergenic
914346181 1:146800146-146800168 ATTTACCTGAAAAAGAATTCAGG + Intergenic
914395584 1:147264509-147264531 TCTTCCTTGGAAAAGAGATCAGG - Exonic
914455440 1:147832632-147832654 ATTTCCCTGAAAAAGAAATCAGG - Intergenic
914875514 1:151510809-151510831 ATTACATAGAAAAAGATGTCAGG + Intronic
915718321 1:157965039-157965061 ATCTCCTTAAACTAGAGGTCTGG + Intergenic
915790664 1:158666806-158666828 ATTTCCTTGAAAAAGAGGTCTGG - Intronic
915810436 1:158903721-158903743 GTTTCTATGAAAAAGAGGCCAGG + Intergenic
916441888 1:164834643-164834665 CTTTCCATGAAAAATAGGGCTGG - Intronic
916457774 1:164988579-164988601 ATTTCATTTCAAAGGAGGTCTGG - Intergenic
917057776 1:171003224-171003246 ATTTTCCTGAAAAAGAATTCAGG - Intronic
917319094 1:173759881-173759903 ATTTACCTGAAAAAGAATTCAGG + Intronic
917461686 1:175235574-175235596 ATTTACCTGAAAAAGAATTCAGG + Intergenic
917898386 1:179516436-179516458 ATTTACATGAAAAAGAATTCAGG - Intronic
918721732 1:187860973-187860995 ATTTACCTGAAAAAGAACTCAGG - Intergenic
919081886 1:192877021-192877043 ATTTCCTTAGAAAAGAAGACAGG - Intergenic
919123028 1:193364461-193364483 ATTTCCTTGAAAAAGGAGTCAGG - Intergenic
919278010 1:195445666-195445688 ATTTACCTGAAAAAGAATTCAGG + Intergenic
919598535 1:199593959-199593981 ATTTGCCTGAAAAAGAATTCAGG + Intergenic
920436830 1:205952347-205952369 CTTTCCTGTAAATAGAGGTCTGG + Intergenic
924057799 1:240141205-240141227 AGATCTTTGAAAAAGATGTCAGG + Intronic
924302211 1:242651484-242651506 ATTTACCTGAAAAAGAATTCAGG - Intergenic
924321306 1:242854133-242854155 ATTTACCTGAAAAAGAATTCAGG - Intergenic
924367205 1:243307608-243307630 TTTTCCTTAAAAAAGGGGTGGGG - Intronic
1063153518 10:3357383-3357405 ATTTTCTTTAAAATGATGTCTGG - Intergenic
1065121394 10:22533872-22533894 GTTACCTTGAAAAAGATGTAAGG + Intergenic
1065375290 10:25033553-25033575 CTTTCCTTGATAAAGAAGTTTGG - Intronic
1065690514 10:28327931-28327953 ATTTCCTTGTTCAACAGGTCAGG - Intronic
1066218506 10:33312374-33312396 ATTTCCTTTAAAAATGGGTCTGG + Intronic
1068480885 10:57586437-57586459 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1069242595 10:66162185-66162207 ATTTACTTGAAAAAGAATTCAGG - Intronic
1071022267 10:81071489-81071511 AATTCCTTGAAACAGAGTTTGGG + Intergenic
1071024080 10:81092213-81092235 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
1071416183 10:85444234-85444256 TTTTCCTTGGAAAAGTAGTCTGG + Intergenic
1071484845 10:86092142-86092164 ATTTACCTGAAAAAGAATTCAGG + Intronic
1072216748 10:93293704-93293726 ATTTCTTTTAAAAAGAGGAGAGG - Intergenic
1072815005 10:98498657-98498679 ATTTACCTGAAAAAGAATTCAGG + Intronic
1072928088 10:99634305-99634327 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1073900367 10:108214403-108214425 ATTTACCTGAAAAAGAATTCGGG - Intergenic
1074807968 10:117072869-117072891 ATTTACTTGAAAAAGAATTTAGG + Intronic
1074849216 10:117425534-117425556 ATTTGCATCATAAAGAGGTCTGG - Intergenic
1075064313 10:119279180-119279202 ATATCTTTATAAAAGAGGTCAGG - Intronic
1075660502 10:124192559-124192581 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1075910814 10:126124208-126124230 ATTTCCTAGAAAAAGACTTTTGG + Intronic
1075982643 10:126754867-126754889 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1076289967 10:129337936-129337958 ATTTCCTTTAAAAAATGGACTGG + Intergenic
1078706646 11:13749853-13749875 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1078786604 11:14500160-14500182 GTTCCCGTGAAAAAGAGCTCTGG + Intergenic
1078885463 11:15495651-15495673 CTTTCCTTCATAAAGATGTCAGG + Intergenic
1079791613 11:24747034-24747056 ATTTACCTGAAAAAGAATTCAGG - Intronic
1080336429 11:31202820-31202842 ATTTCCCAGGAAAAGAGGCCAGG + Intronic
1080672435 11:34394061-34394083 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1080911023 11:36598874-36598896 ATTTACTTCAAAAAGTTGTCGGG + Intronic
1080989341 11:37511389-37511411 ATTTTCTTGAATAAGAGGTATGG - Intergenic
1081806651 11:45894521-45894543 ACTTCCTTGGACAATAGGTCTGG - Intronic
1081896374 11:46590655-46590677 ATTTCCTTTAAAAACTGGACGGG - Intronic
1082140403 11:48602664-48602686 ATTTTCCTGAAAAAGAATTCAGG - Intergenic
1082567574 11:54699645-54699667 ATTTTCCTGAAAAAGAATTCAGG - Intergenic
1082711907 11:56562538-56562560 CATTTCTTGAAAAACAGGTCTGG - Intergenic
1082903999 11:58286089-58286111 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1083351666 11:62033809-62033831 ATTTCCTGTAAACAGAAGTCTGG - Intergenic
1085747928 11:79130395-79130417 ATGTACCTGAAAAAGAAGTCAGG + Intronic
1086300577 11:85422923-85422945 ATTTACCTGAAAAAGAATTCAGG - Intronic
1087320739 11:96655292-96655314 ATTGACTTGAAAAAGATTTCAGG - Intergenic
1088073540 11:105818967-105818989 ATTTCCTTGTATAAAAGGTGTGG - Intronic
1088137603 11:106577286-106577308 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1088730392 11:112676689-112676711 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1089907559 11:122058061-122058083 AGTTCTTTGAAGAATAGGTCTGG - Intergenic
1090529199 11:127573244-127573266 TTTCCCATGAAAAATAGGTCAGG + Intergenic
1090757420 11:129804506-129804528 ATTTACCTGAAAAAGAACTCAGG + Intergenic
1091210412 11:133853791-133853813 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1092208444 12:6631034-6631056 CCTGCCTTGAAGAAGAGGTCAGG + Intronic
1093010633 12:14102672-14102694 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1093166926 12:15814964-15814986 ATTTCACTCAAAAAGAAGTCTGG + Intronic
1093172697 12:15876705-15876727 ATTTACCTGAAAAAGAATTCAGG + Intronic
1093566056 12:20605089-20605111 GTTCCCTTGAAAACGAAGTCAGG - Intronic
1093901612 12:24641507-24641529 ATTGCCTAGAAAAAGGGGACAGG + Intergenic
1094447248 12:30545506-30545528 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1094501423 12:31024020-31024042 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1094718004 12:33032973-33032995 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1095227792 12:39697335-39697357 ATTTTCTTGCAGAACAGGTCTGG - Intronic
1095286219 12:40413868-40413890 GTTTTCTTGAAAAAGAAGGCTGG + Intronic
1095665285 12:44789631-44789653 ATTTACCTGAAAAAGAATTCAGG + Intronic
1095892885 12:47250793-47250815 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1096515717 12:52154077-52154099 ATTTCCCTCCAAAATAGGTCAGG - Intergenic
1096956958 12:55535506-55535528 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1097295608 12:57958895-57958917 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1097385855 12:58949728-58949750 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1098960821 12:76738477-76738499 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1099681265 12:85831433-85831455 ATTTTCTTGAAAAACAATTCAGG + Intronic
1099829956 12:87828774-87828796 TTTTCCTTGGAAAATATGTCTGG - Intergenic
1100088021 12:90935928-90935950 ATTTACCTGAAAAAGAATTCAGG - Intronic
1100970435 12:100063946-100063968 ATTTACTTGAAAAAGAATTCAGG + Intronic
1101447968 12:104751373-104751395 ATTTCCTTTAAACACAGGTTTGG + Intronic
1101635155 12:106534785-106534807 ATTTACCTGAAAAAGAATTCAGG - Intronic
1101800046 12:108013795-108013817 ATGACCTTGAAAAATAAGTCAGG - Intergenic
1101899771 12:108782986-108783008 ATTTTGTTGCAAAAGAGCTCAGG + Exonic
1102886185 12:116523721-116523743 ATTTCCTTGGCAATCAGGTCAGG - Intergenic
1103161051 12:118729688-118729710 ATTTCTTTGAAGATAAGGTCTGG - Intergenic
1103760996 12:123250354-123250376 ATTTACCTGAAAAAGAATTCAGG - Intronic
1103916317 12:124377517-124377539 GTTACCTTGTAAAAGAGTTCTGG + Intronic
1104044773 12:125154059-125154081 ATTTCCTTGAAAAATATCTTGGG + Intergenic
1104504397 12:129318124-129318146 ATTTACCTGAAAAAGAGTTCAGG - Intronic
1105271847 13:18883939-18883961 ACTTGCACGAAAAAGAGGTCAGG + Intergenic
1107184943 13:37506519-37506541 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1107461938 13:40612527-40612549 ATTTCTTTCAAAAAGAAGGCTGG + Intronic
1108482362 13:50886992-50887014 GCTTCATTGAAAATGAGGTCTGG - Intergenic
1109213470 13:59562361-59562383 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1109508304 13:63336247-63336269 ATTTACTTGAAAAAGAATTCAGG - Intergenic
1110042379 13:70779620-70779642 TTTTCCTTGAAAAATAGGAATGG - Intergenic
1110432474 13:75440955-75440977 ATTTTTTTAAAAAAGAGGACAGG + Intronic
1110561975 13:76918764-76918786 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1110838958 13:80119516-80119538 ATTTTCTTAAAATAGAGGTTTGG - Intergenic
1110852514 13:80261985-80262007 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1110881668 13:80578813-80578835 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1111116044 13:83779472-83779494 ACTTCCTGGAGAAAGAGGACTGG + Intergenic
1112035242 13:95491647-95491669 ATTTACCTGAAAAAGAATTCAGG - Intronic
1112052842 13:95661276-95661298 AATAGCTTGAACAAGAGGTCTGG + Intergenic
1112428090 13:99323273-99323295 AGTTCATTGAAAATGAGGACAGG + Intronic
1114370301 14:22079419-22079441 ATTTTCTTGACAAAGAGTTTTGG - Intergenic
1114414066 14:22527761-22527783 ATCTCCTTGAAAAAGATGGGTGG + Intergenic
1114829622 14:26124822-26124844 ATTACCTAGATAAAGCGGTCTGG - Intergenic
1115271776 14:31560920-31560942 AGTTCCCTGAAAGAAAGGTCAGG - Intronic
1115350536 14:32390331-32390353 ATTTACCTGAAAAAGAATTCAGG - Intronic
1115527126 14:34292726-34292748 ATTTACCTGAAAAAGAATTCAGG - Intronic
1115680421 14:35731392-35731414 ATTTACCTGAAAAAGAATTCAGG + Intronic
1115835377 14:37396959-37396981 ATTTACCTGAAAAAGAATTCAGG - Intronic
1115958632 14:38809759-38809781 ATTTGCCTGAAAAAGAATTCAGG + Intergenic
1116283077 14:42934306-42934328 ATATCCTTGAATAAAAAGTCTGG - Intergenic
1116663143 14:47738256-47738278 AATTCCTTGAGAACGAGGTTGGG + Intergenic
1117178192 14:53166673-53166695 TTTTCCTTAAAAAAAAGGTGGGG - Intergenic
1118273894 14:64368360-64368382 ATTTCTTTTAAAAAGTAGTCTGG + Intergenic
1118491772 14:66268133-66268155 GTTTCCTGGAAAATGAGGTGTGG - Intergenic
1118511326 14:66477385-66477407 TTTTCCATGTAAAAGAAGTCTGG + Intergenic
1119643350 14:76330548-76330570 ACTTCCTGGAGTAAGAGGTCGGG + Intronic
1120545656 14:85808641-85808663 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1123104112 14:105829872-105829894 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1123486293 15:20742606-20742628 ACTTTCATCAAAAAGAGGTCAGG + Intergenic
1123496729 15:20834169-20834191 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1123542784 15:21311662-21311684 ACTTTCATCAAAAAGAGGTCAGG + Intergenic
1123553964 15:21407761-21407783 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1123590208 15:21845126-21845148 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1124380840 15:29163321-29163343 ATTTACCTGAAAAAGAATTCAGG + Intronic
1125055826 15:35358363-35358385 ATTTACCTGAAAAAGAATTCAGG - Intronic
1125273265 15:37963980-37964002 ATTTACCTGAAAAAGAATTCAGG - Intronic
1126294792 15:47127927-47127949 ATTTACTTGTAGAATAGGTCTGG + Intergenic
1126460664 15:48912572-48912594 ATTTACCTGAAAAAGAATTCAGG - Intronic
1128238844 15:66085831-66085853 ATTTACATGAAAAAGAATTCAGG + Intronic
1128415131 15:67437562-67437584 ATTTACATGAAAAAGAATTCAGG + Intronic
1130731480 15:86497790-86497812 ATTTACATGAGAAAAAGGTCAGG - Intronic
1130779692 15:87022324-87022346 ATTTACCTGAAAAAGAATTCAGG + Intronic
1131979830 15:97984182-97984204 ATTTCCTGGAAAGAGAGATAGGG + Intergenic
1202951102 15_KI270727v1_random:38792-38814 ACTTTCATCAAAAAGAGGTCAGG + Intergenic
1202962311 15_KI270727v1_random:134957-134979 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1133407732 16:5539014-5539036 GGGTCCTTGAAAAAGAGGTTGGG + Intergenic
1133834476 16:9354500-9354522 ATTTTCTTCAAGATGAGGTCAGG + Intergenic
1134611174 16:15609431-15609453 ACTTCCCAGAAAAACAGGTCTGG + Intronic
1134652887 16:15924934-15924956 GTTACCCTGAAGAAGAGGTCAGG + Intergenic
1135007510 16:18839740-18839762 ATCTCCTTGCCAAAGAGCTCTGG - Exonic
1135842874 16:25892748-25892770 ATTCCCTGGAAAAGGAGGGCGGG - Intronic
1136028414 16:27485091-27485113 TCTTCCTTGGAAAAGAGGTTGGG + Intronic
1136132852 16:28234875-28234897 ATGTCCTTATAAAAGAGGTTTGG - Intergenic
1137308042 16:47224445-47224467 ATTTCCTTAAAAGAGAGGTTAGG - Intronic
1137793062 16:51191215-51191237 AATTACTTTAAAAAGAAGTCTGG - Intergenic
1137902157 16:52280251-52280273 ATTACTGTGAAAAAGAGGTTTGG - Intergenic
1138881132 16:61015559-61015581 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1139217239 16:65138665-65138687 GTTTCCTTGAGAAAGAAATCTGG - Intergenic
1139987798 16:70915121-70915143 ATTTACCTGAAAAAGAATTCAGG - Intronic
1140464724 16:75172106-75172128 ATTTCCTTGAAAAGAATGTGTGG + Exonic
1140619920 16:76717233-76717255 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1140851906 16:78942913-78942935 ATTTCCTTGAGAGAGAGGAGGGG - Intronic
1141548612 16:84789104-84789126 ATTTCCGTGAAAAAGGTGCCGGG - Intergenic
1143313984 17:6017452-6017474 ATTTCCTTAGAAAAGAGGACAGG - Intronic
1143990945 17:10960589-10960611 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1145038775 17:19560959-19560981 ATTTTTTTTAAAAAGAGGCCGGG + Intronic
1145856740 17:28166491-28166513 TTTTATTTGAAAAAGAGTTCCGG - Intronic
1146583504 17:34060504-34060526 ATTTACGTGAAAAAGAATTCAGG + Intronic
1146673432 17:34757284-34757306 ATGGCCTTGAAAGGGAGGTCAGG + Intergenic
1146834529 17:36099555-36099577 GTTTACTTGGGAAAGAGGTCAGG + Intergenic
1147463075 17:40588420-40588442 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
1148044007 17:44731302-44731324 AGTTACTTGTAAAAGAAGTCTGG - Intronic
1148397389 17:47320608-47320630 ATTTCCATGAAAAATAACTCTGG - Intronic
1149344599 17:55721759-55721781 AATTCATTGAAAATGAGGTGGGG + Intronic
1149738740 17:59022810-59022832 ATTTCCTTGAATAGCAGGTGAGG - Intronic
1149739044 17:59025859-59025881 ATTTCCTTGAATAGCAGGTGAGG + Intronic
1149984925 17:61340122-61340144 AACTCCTTGAAAGAGATGTCTGG - Intronic
1150539061 17:66077210-66077232 ATTTACCTGAAAAAGAATTCAGG + Intronic
1150927516 17:69548872-69548894 TTTTGCTTGAAAAAGAAATCTGG - Intergenic
1152106952 17:78335826-78335848 ATTTCTATGAGAAAGAGGCCAGG - Intergenic
1152731477 17:81973659-81973681 ATTTCCTTGTAAAAGGGATTGGG + Intergenic
1153091434 18:1349748-1349770 ATTACCTTGAAAATGCAGTCAGG + Intergenic
1153166471 18:2267329-2267351 ATTTCCTTGGAGAAGAGATCCGG + Intergenic
1153554761 18:6299965-6299987 ATTGTATTGAAAAATAGGTCAGG - Intronic
1153972645 18:10240457-10240479 ATTTCCTATAAAAAGTGGTTTGG + Intergenic
1154090593 18:11357176-11357198 ATTGCCTTGATAAATAGGGCTGG + Intergenic
1154454639 18:14509853-14509875 ACTTGCTTAAAAAAGAAGTCTGG - Intronic
1156011263 18:32500686-32500708 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1157218704 18:45807886-45807908 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1157540973 18:48506203-48506225 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1158011811 18:52737337-52737359 ATTGGCTTTAAAAAGATGTCTGG - Intronic
1158895335 18:61907590-61907612 ATTCCCTTGAAAAGCATGTCAGG - Intergenic
1158953382 18:62518244-62518266 ATTTCAAAGAAAAAGAGGTTGGG - Intergenic
1159646841 18:70928956-70928978 TTTTCTTTGAAACAGATGTCAGG - Intergenic
1159708456 18:71722762-71722784 ATTTCTCTGAAAAAGTGGTGAGG - Intergenic
1160055428 18:75474789-75474811 ATGTCCTTTACAAAGAGTTCTGG - Intergenic
1160219641 18:76965368-76965390 ATTTACCTGAAAAAGAATTCAGG - Intronic
1162323916 19:9987063-9987085 TTTGCCTTTAAAATGAGGTCCGG - Intronic
1166796215 19:45427894-45427916 ATTTCCTTGAAGCAGAAGTGCGG + Intronic
1168515299 19:57005902-57005924 ATTACTTTCAAAAGGAGGTCAGG + Intergenic
925561972 2:5205854-5205876 ATATCCTAGATAAAGAGTTCAGG - Intergenic
925695924 2:6578245-6578267 ATTTACTTAAAAAAAAGGTATGG - Intergenic
926322351 2:11757707-11757729 ATTTCTTTGAAAGAGAGCTTGGG - Intronic
926826139 2:16906805-16906827 TTTTCTTTAAAAATGAGGTCAGG + Intergenic
926924296 2:17971368-17971390 ATTCCCTTCAAAGAGGGGTCAGG + Intronic
927328229 2:21831813-21831835 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
927363380 2:22264104-22264126 ATTTACCTGAAAAAGAATTCAGG - Intergenic
928191772 2:29177035-29177057 ATTGCCATGAAAAAAAAGTCAGG - Intronic
929329974 2:40671084-40671106 TTTTCCATGAAAGAGAGATCTGG - Intergenic
929722794 2:44388488-44388510 ATTTACCTGAAAAAGAATTCAGG - Intronic
930860942 2:56071866-56071888 ATTCCCTTTAACAAAAGGTCTGG - Intergenic
931547991 2:63409557-63409579 ATTTACCTGAAAAAGAATTCAGG + Intronic
931647529 2:64438171-64438193 ATTCCCTTGAATAAGAAATCTGG + Intergenic
931941250 2:67254288-67254310 TTTTCCTTGCCAAAGAGATCAGG - Intergenic
932100546 2:68895914-68895936 ATTTACCTGAAAAAGAATTCAGG - Intergenic
932776834 2:74533285-74533307 ATTTTCTTTAATAGGAGGTCAGG - Exonic
936115906 2:109702847-109702869 TTTTCCTGGAAACAGAGGTGGGG + Intergenic
937010690 2:118560237-118560259 ATTTGCTTGAAAAAGAAGAGTGG - Intergenic
937069143 2:119049621-119049643 ATTTACCTGAAAAAGAATTCAGG - Intergenic
937521901 2:122721652-122721674 ATTTACCTGAAAAAGAATTCAGG + Intergenic
938761270 2:134428423-134428445 CTTTCATTGAAAAACAGGTAAGG + Exonic
938827639 2:135021934-135021956 ATTTTCCTGAAATAGTGGTCTGG + Intronic
939092700 2:137798142-137798164 ATTCCCTTGGAAATTAGGTCTGG + Intergenic
939769673 2:146299538-146299560 ATTTACTTGTAAAAGAACTCAGG + Intergenic
940034605 2:149301046-149301068 ATTTACCTGAAAAAGAATTCCGG - Intergenic
940702810 2:157067263-157067285 TTTTTCTTGAAACAGAAGTCAGG - Intergenic
941631507 2:167890439-167890461 ATTTACCTGAAAAAGAATTCAGG - Intergenic
941746855 2:169095944-169095966 TTTTCTTTGAAAAGGAGGGCTGG + Exonic
942470001 2:176250476-176250498 ATTTACCTGAAAAAGAATTCAGG - Intergenic
944528763 2:200648071-200648093 ATTTACCTGAAAAAGAATTCAGG - Intronic
944563993 2:200969116-200969138 ATTTCATAGAAAAAGAGTTGAGG + Intergenic
944631469 2:201630275-201630297 ATTTCTTAGGAAAAGATGTCAGG + Intronic
944890999 2:204117372-204117394 ATTTCCTATAAATAGAGGTATGG - Intergenic
945852338 2:215023924-215023946 AATTCCTTGACAAGGAAGTCAGG + Intronic
946466684 2:219918336-219918358 ATTTCCCTTAAAAAGAAGACAGG + Intergenic
946501403 2:220250887-220250909 ATTTACCTGAAAAAGAATTCAGG + Intergenic
946655115 2:221937949-221937971 ATTTTTTTGAAAAAGAAGTTTGG + Intergenic
947948251 2:234125056-234125078 ATTTTCTTAAAAAAGGGCTCAGG + Intergenic
1169715197 20:8608309-8608331 ATTTCTTTGAAAATGAGCTTTGG + Intronic
1170133644 20:13050094-13050116 ATTTACCTGAAAAAGAATTCAGG + Intronic
1170812558 20:19685968-19685990 ATTTCCTGAGAAAAGAGCTCAGG + Intronic
1171081483 20:22190255-22190277 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1172003235 20:31798022-31798044 ATTTTTTTGAAAAAGAGATGGGG - Intronic
1173530743 20:43767397-43767419 ATTTGCCTGAAAAAGGAGTCTGG + Intergenic
1173793495 20:45842908-45842930 ACTCCCTTGGAAAGGAGGTCAGG + Intronic
1174885003 20:54323868-54323890 ATTTCATTGAACAAGAAATCTGG - Intergenic
1175069188 20:56317232-56317254 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1176819529 21:13643455-13643477 ACTTGCTTAAAAAAGAAGTCTGG + Intergenic
1177176574 21:17705753-17705775 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1177195472 21:17900170-17900192 ATTTACATGAAAAAGAATTCAGG - Intergenic
1177995233 21:28089284-28089306 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1178059496 21:28835646-28835668 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1178801792 21:35802061-35802083 ATTTACTTGAAAAAGAATTCAGG + Intronic
1178959155 21:37048021-37048043 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1181129273 22:20720717-20720739 ATTTCCTTGTAGAAGACGGCTGG - Intronic
1182084750 22:27553870-27553892 ATTTCTTAGATAAAGTGGTCAGG - Intergenic
1184655877 22:45941895-45941917 ACTTCCCTGAAGAATAGGTCAGG + Intronic
1184970402 22:48016027-48016049 CTCTCCTTGAAACAGAGGCCAGG + Intergenic
949603923 3:5633664-5633686 ATTTTCCTGAAAAAGAATTCAGG - Intergenic
949814373 3:8041798-8041820 ATTTACCTGAAAAAGAATTCAGG + Intergenic
950011360 3:9726507-9726529 ACATCCTTGAAAAAGTAGTCTGG + Intronic
950565534 3:13767669-13767691 ATTTTCTAGAAAAACAGGTATGG - Intergenic
950592291 3:13947189-13947211 ATTTACCTGAAAAAGAATTCAGG - Intronic
950870623 3:16225399-16225421 ATTTTTTTAAAAAAGAGGCCAGG + Intronic
950923293 3:16716411-16716433 ATCTGCTTAAAAAAGAAGTCTGG + Intergenic
951764124 3:26178433-26178455 ATTTACCTGAAAAAGAATTCAGG - Intergenic
951852016 3:27151664-27151686 ATTTACCTGAAAAAGAATTCAGG + Intronic
953723835 3:45380856-45380878 ATTTACCTGAAAAAGAATTCAGG - Intergenic
953866526 3:46587732-46587754 ATTTACCTGAAAAAGAATTCAGG + Intronic
954212048 3:49103459-49103481 CTTTCCTTGGGAAAGAGGTGGGG - Intronic
955175519 3:56610551-56610573 ATTTACCTGAAAAAGAATTCAGG - Intronic
955369193 3:58336446-58336468 ATTTCCTTGCAGCAGAGGGCTGG - Intronic
955461505 3:59188981-59189003 ATTTACCTGAAAAAGAATTCAGG - Intergenic
956369902 3:68548166-68548188 TTTTCCTTGTGAAAGAGCTCAGG + Intergenic
956950376 3:74274812-74274834 ATTTACTGGAAAAAGAATTCAGG + Intronic
957182547 3:76899155-76899177 ATTACCTTGAAAAATAAATCTGG - Intronic
957896577 3:86427658-86427680 ATTTCCTTGCAAAATAGATTAGG - Intergenic
958643313 3:96837080-96837102 AATTCCTTGATACAAAGGTCAGG + Intronic
958770782 3:98422632-98422654 ATTTACCTGAAAAAGAATTCAGG + Intergenic
959039585 3:101405586-101405608 ATTTACCTGAAAAAGAATTCAGG + Intronic
959275117 3:104268962-104268984 ATTTACCTGAAAAAGAATTCAGG - Intergenic
959279877 3:104324136-104324158 ATTTACCTGAAAAAGAATTCAGG + Intergenic
959436244 3:106318049-106318071 ATTTACCTGAAAAAGAATTCAGG + Intergenic
959802412 3:110511667-110511689 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
959875269 3:111374332-111374354 ATTTACCTGAAAAAGAATTCAGG + Intronic
960124721 3:113985888-113985910 ATTGCCCTGAACAACAGGTCTGG + Intronic
960512742 3:118570971-118570993 ATTTACCTGAAAAAGAATTCAGG - Intergenic
961975762 3:131023405-131023427 TTCTCCTTGAAAAGGTGGTCTGG + Intronic
962401739 3:135066680-135066702 ATTTACCTGAAAAAGAATTCAGG - Intronic
963213294 3:142717704-142717726 ATTTACCTGAAAAAGAATTCAGG + Intergenic
963779074 3:149469125-149469147 ATTTCTTTCATAAAGAGGTGAGG + Intergenic
964146091 3:153465523-153465545 AATTCCATGAAAAATAGGGCAGG - Intergenic
964230031 3:154454939-154454961 ATTTCTTTCAAAAAGCAGTCTGG - Intergenic
964518313 3:157536887-157536909 ATTTACCTGAAAAAGAATTCAGG - Intergenic
964796376 3:160502278-160502300 ATTACCCTTAAAAAAAGGTCTGG + Intronic
964916237 3:161845725-161845747 ATTTACCTGAAAAAGAAATCAGG - Intergenic
965181541 3:165410398-165410420 ATTTCTTATAAAAAGAGGTTTGG - Intergenic
965321772 3:167260811-167260833 ATTTACCTGAAAAAGAATTCAGG - Intronic
965874273 3:173298768-173298790 ATTTACCTGAAAAAGAATTCAGG - Intergenic
966623848 3:181995323-181995345 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
967067233 3:185929510-185929532 ATTTCCCTGAAAAAATGCTCAGG + Intronic
967257412 3:187608314-187608336 ATTTACCTGAAAAAGAATTCAGG - Intergenic
970217413 4:13774552-13774574 ATTTACCTGAAAAAGAATTCAGG - Intergenic
970312165 4:14793808-14793830 ATTTACCTGAAAAAGAATTCAGG + Intergenic
970549193 4:17162896-17162918 ATTTACCTGAAAAAGAATTCAGG - Intergenic
971474597 4:27060753-27060775 ATTTACTTGAAAAAGCGTTTTGG - Intergenic
972137794 4:35914063-35914085 ATTTCAGTGGAAGAGAGGTCAGG + Intergenic
972188960 4:36567920-36567942 ATTTACCTGAAAAAGAATTCGGG - Intergenic
972651615 4:41022885-41022907 CTTTCCTTGAAAAAAAGGAAAGG + Intronic
973069051 4:45834995-45835017 ATTTACCTGAAAAAGAATTCAGG - Intergenic
973787186 4:54342859-54342881 ATTTACCTGAAAAAGAATTCAGG + Intergenic
973831453 4:54764138-54764160 ATTTACTTGAAAAAGAATTCAGG - Intergenic
973913629 4:55610165-55610187 AGTTAAATGAAAAAGAGGTCGGG + Intronic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
974951078 4:68583258-68583280 ATTTACCTGAAAAAGAATTCAGG + Intronic
975034077 4:69659201-69659223 ATTTACCTGAAAAAGAATTCAGG + Intergenic
975768656 4:77697234-77697256 ATTTCTTTGAAAAAAAAGTATGG + Intergenic
975973558 4:80071754-80071776 CTTAGCTTGAAAAAGAGGCCAGG - Intronic
976275161 4:83268828-83268850 ATTTACTTGAAGAATATGTCTGG - Intronic
976856596 4:89610934-89610956 ATTTACCTGAAAAAGAATTCAGG + Intergenic
977019886 4:91746184-91746206 ATTTAACTGAAAAAGAAGTCAGG - Intergenic
978220920 4:106273341-106273363 TTTTCTTTAGAAAAGAGGTCAGG - Intronic
978670828 4:111245144-111245166 ATTTACCTGAAAAAGAATTCAGG + Intergenic
979561765 4:122108946-122108968 ATTTACCTGAAAAAGAATTCAGG + Intergenic
979704948 4:123709888-123709910 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
979780633 4:124647225-124647247 ATCTCCAATAAAAAGAGGTCAGG + Intergenic
979864457 4:125736507-125736529 ATTTCCTTCAAAAATATGCCAGG - Intergenic
980237965 4:130132631-130132653 ATTTACCTGAAAAAGAAATCAGG + Intergenic
980523744 4:133962290-133962312 GTTTACTTGAAAAAGAATTCAGG + Intergenic
980603364 4:135056470-135056492 ATTTCCTTGAATTAGAGTTCTGG + Intergenic
981400867 4:144312885-144312907 ATTTACCTGAAAAAGAATTCAGG - Intergenic
981626076 4:146757014-146757036 ATTTACCTGAAAAAGAATTCAGG - Intronic
981729531 4:147883231-147883253 ATGTCAGTGAAAAAGAGGTTGGG + Intronic
981880667 4:149607363-149607385 AATTTCTTGGAAAACAGGTCTGG - Intergenic
982075110 4:151730934-151730956 ATTTACCTGAAAAAGAATTCAGG + Intronic
982106704 4:152017648-152017670 ATTTCCTGGCAAAAGAGGAGTGG - Intergenic
982356890 4:154480799-154480821 ATTTTCTTGAAATAGAGATAGGG + Intronic
982512390 4:156299369-156299391 ATCTCCATGAAAAAGAGGAGAGG - Intergenic
982528089 4:156505295-156505317 ATTTCCTTAAGAAATATGTCTGG + Intergenic
982864506 4:160493213-160493235 GTTTCCTTGTAAAAGAGATGGGG + Intergenic
983152528 4:164302435-164302457 CTTTTCTTAAAAAAGAGGTTTGG - Intronic
984192516 4:176622814-176622836 ACATCCTTGAGGAAGAGGTCTGG - Intergenic
984388412 4:179095392-179095414 ATTTCTTTGGAGAAGAAGTCAGG + Intergenic
984601410 4:181731166-181731188 ATTTTTTTAAAAAAGAGGACAGG + Intergenic
985217628 4:187671223-187671245 ATTTACCTGAAAAAGAATTCAGG - Intergenic
985340894 4:188952795-188952817 ACTTCCTTTAAACATAGGTCAGG + Intergenic
989497889 5:42130866-42130888 ATTTCTTTGAAGGAGATGTCAGG + Intergenic
990039329 5:51360614-51360636 GTTTCCTTGACAATGAGGTAGGG - Intergenic
991117494 5:62970718-62970740 ATTTACCTGAAAAAGAATTCAGG + Intergenic
991136569 5:63189108-63189130 ATTACTTTGATGAAGAGGTCAGG - Intergenic
991337932 5:65571148-65571170 AAATTCTTGAAGAAGAGGTCTGG + Intronic
991387072 5:66101858-66101880 ATTTACCTGAAAAAGAACTCAGG + Intergenic
991923985 5:71685084-71685106 ATTTCCCTGAAAAAGAATTCAGG + Intergenic
992058581 5:73019096-73019118 AATCCCTTAAAAATGAGGTCTGG - Intronic
992520262 5:77543313-77543335 ATTTACCTGAAAAAGAATTCAGG + Intronic
993027987 5:82667832-82667854 ATTTCCTTTAAAAAAGGGGCAGG - Intergenic
993883774 5:93394075-93394097 ATTTACCTGAAAAAGAATTCAGG - Intergenic
993917165 5:93756883-93756905 ATTTACCTGAAAAAGAATTCAGG + Intronic
993964872 5:94347800-94347822 ATTTACCTGAAAAAGAATTCAGG + Intronic
994527456 5:100924854-100924876 ATTTACCTGAAAAAGAATTCAGG - Intergenic
995087780 5:108135085-108135107 ATTTCTTTGAAGAAGGGATCTGG + Intronic
995472895 5:112522598-112522620 ATTTACCTGAAAAAGAATTCAGG - Intergenic
995796575 5:115947353-115947375 CTTTCCTTGGTAAAGAGGCCAGG + Intergenic
995817931 5:116192326-116192348 ATTTACCTGAAAAAGAGTTCAGG + Intronic
996010863 5:118479867-118479889 ATTTACCTGAAAAAGAATTCAGG + Intergenic
996031917 5:118714780-118714802 ATTTACCTGAAAAAGAATTCAGG + Intergenic
996288829 5:121828321-121828343 ATTTACCTGAAAAAGAATTCAGG - Intergenic
996325519 5:122268177-122268199 ATTTACCTGAAAAAGAATTCAGG + Intergenic
996504683 5:124256530-124256552 ATTTACCTGAAAAAGAATTCAGG - Intergenic
996604071 5:125300293-125300315 ATTTCCCTGAAACAGAATTCTGG + Intergenic
996604075 5:125300331-125300353 ATTTCCCTGAAACAGAATTCTGG + Intergenic
996944177 5:129046803-129046825 ATTTACTTGAAAATTAGGTATGG - Intergenic
998882590 5:146658409-146658431 TCTTCCTTGAAAATGAAGTCTGG - Intronic
998940967 5:147281263-147281285 ATTTACCTGAAAAAGAATTCAGG + Intronic
999144694 5:149384605-149384627 ATGTCCTTGAAAGAGAGGTGGGG + Intronic
999179970 5:149662663-149662685 ATTTTTTTAAAAAAGAGGCCAGG + Intergenic
999484700 5:151984309-151984331 ATTTACCTGAAAAAGAATTCAGG - Intergenic
999818731 5:155202762-155202784 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1000757803 5:165183465-165183487 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1000779764 5:165465690-165465712 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1003029323 6:2588572-2588594 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1003582071 6:7348574-7348596 ATTTACCTGAAAAAGAATTCAGG + Intronic
1004827923 6:19443913-19443935 ATTTCTTTGAAAAAAATCTCAGG - Intergenic
1005072607 6:21875332-21875354 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1006089946 6:31622495-31622517 ATTTCCTTGACAAAGGTGTCTGG + Intronic
1006940970 6:37752037-37752059 GTTTCCTTGGAAAAGAAGTCGGG + Intergenic
1007268682 6:40618764-40618786 ATCTTCTTGCAAAAGAGGTTGGG - Intergenic
1007689015 6:43686423-43686445 ATTTGCTAGAAAAAAAAGTCTGG - Intronic
1008171193 6:48208356-48208378 ATTATGTTGAAAAAGAAGTCAGG - Intergenic
1009493785 6:64325574-64325596 ATTTACCTGAAAAAGAATTCAGG + Intronic
1009968947 6:70605654-70605676 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1011789615 6:90884793-90884815 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1011893194 6:92193392-92193414 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1012156064 6:95820661-95820683 ATTTACCTGAAAAAGAATTCTGG + Intergenic
1012208261 6:96488730-96488752 ATTTACCTGAAAAAGAATTCGGG - Intergenic
1012225188 6:96695073-96695095 ATTTACCTGAAAAAGAAATCAGG + Intergenic
1012737936 6:102974391-102974413 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1012744433 6:103066778-103066800 AATTCCTTGTAAGAGAGGTCTGG + Intergenic
1012958184 6:105593194-105593216 ATTTACGTGACAAAGAAGTCAGG + Intergenic
1012985580 6:105872594-105872616 TTTTCCTTGAAAGAGAGTTCTGG - Intergenic
1013494228 6:110682103-110682125 ATGCCCTTGAAAAAGGAGTCAGG - Intronic
1013720938 6:113027698-113027720 ATTTACCTGAAAAAGAAGTCAGG - Intergenic
1013900898 6:115155510-115155532 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1014124204 6:117758816-117758838 ACTTACTTTAAAAAGTGGTCTGG - Intergenic
1014336934 6:120148138-120148160 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1014604007 6:123449229-123449251 ATTTACCTGAAAAAGAATTCAGG + Intronic
1015518710 6:134110823-134110845 ATTTACTTGATAACGAGGCCAGG + Intergenic
1015663201 6:135599726-135599748 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1015849679 6:137559445-137559467 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1016289911 6:142517918-142517940 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1016714986 6:147215233-147215255 ATATCCTTTAAAAACAAGTCAGG - Intronic
1016942499 6:149494701-149494723 ACTTGCTTTAAAAAGAGTTCTGG + Intergenic
1017686234 6:156915910-156915932 ATTTGGTTAAAAAAGAGGTGGGG - Intronic
1018009517 6:159656429-159656451 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1018665746 6:166135809-166135831 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1020378016 7:7509695-7509717 ATTTCATTGACTAAGATGTCAGG - Intronic
1020635014 7:10685705-10685727 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1020691491 7:11360202-11360224 TTTTGCTTGAAAAGGAGGTGTGG + Intergenic
1021052145 7:16000482-16000504 ATTTCCTTGAAAATAATTTCAGG - Intergenic
1022718014 7:32916138-32916160 AATTCCTGGAAGAAGAGGACCGG + Intergenic
1022777598 7:33544182-33544204 ATTTACCTGAAAAAGAATTCAGG - Intronic
1023748861 7:43350848-43350870 ATTTACCTGAAAAAGAATTCAGG - Intronic
1024200345 7:47100163-47100185 GTTGCCTTGAAAATGAGATCAGG + Intergenic
1024669184 7:51576804-51576826 ATTTACCTGAAAAAAAGTTCAGG - Intergenic
1024745254 7:52399269-52399291 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1024772010 7:52734747-52734769 ATCTCCTGGAGAAAGAGGTCAGG + Intergenic
1024917111 7:54514547-54514569 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1027295488 7:76764878-76764900 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1027328921 7:77070975-77070997 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1027350340 7:77305692-77305714 ATTTCCCTGAAAAAGAATTCAGG - Intronic
1028182841 7:87746955-87746977 ATTTACCTGAAAAAGAATTCAGG - Intronic
1028823398 7:95240167-95240189 TTTTCCCTGAAAAAGTGGTAGGG + Intronic
1029028657 7:97445493-97445515 ATTGACTTGAAAAATAGATCTGG - Intergenic
1029634172 7:101772907-101772929 ATTTCCAGGAAAAGTAGGTCTGG + Intergenic
1030405283 7:109103016-109103038 ATTTCCATGAAATAGACATCAGG - Intergenic
1030618453 7:111763314-111763336 GATTCCTTAAAAAAAAGGTCAGG + Intronic
1031473378 7:122193257-122193279 ATTTCCTTGAAACCCATGTCTGG - Intergenic
1031740859 7:125428601-125428623 ATTTCCATAAAATAGATGTCAGG + Intergenic
1031879335 7:127178008-127178030 ATTTACCTGAAAAAGAACTCAGG + Intronic
1032772748 7:135075889-135075911 ACTACCTTGAAAAAGGGGTTGGG + Intronic
1034070137 7:148176518-148176540 ATCTCTTTGAAAAAGGGCTCTGG - Intronic
1034683076 7:152946309-152946331 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1035729602 8:1844769-1844791 TTTTAATTGAAAATGAGGTCGGG + Intronic
1036025702 8:4906249-4906271 ATTTACTTGGAAAAGAGTTCAGG - Intronic
1037713492 8:21375841-21375863 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1038400469 8:27280501-27280523 ATAGGCTTAAAAAAGAGGTCAGG - Intergenic
1039095440 8:33880208-33880230 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1039123697 8:34176343-34176365 ATTTACATGAAAAAGAATTCAGG + Intergenic
1039641580 8:39228338-39228360 ATTTACCTGAAAAAGAAATCAGG + Intronic
1040087920 8:43365070-43365092 ACTTGCTTAAAAAAGAAGTCTGG + Intergenic
1040404492 8:47086737-47086759 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1040766143 8:50913551-50913573 AGCTCCTTTAAAAAGAGGTAAGG + Intergenic
1040942356 8:52845939-52845961 TTCTCCTTGTACAAGAGGTCAGG - Intergenic
1041293592 8:56332492-56332514 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1041411742 8:57563810-57563832 ATTCTCTTTAAAAAGATGTCAGG + Intergenic
1041570431 8:59332397-59332419 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1041637229 8:60157202-60157224 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1041877872 8:62711722-62711744 ATTTACCTGAAAAAGAATTCAGG - Intronic
1042065563 8:64871103-64871125 CTTTCTTTGAAAATGAGATCAGG + Intergenic
1042088716 8:65134604-65134626 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1042304033 8:67313265-67313287 ATTTACCTGAAAAAGAGTTCAGG - Intronic
1042348661 8:67753393-67753415 ATTCCATTGAAAAAAAGGTTTGG - Intergenic
1042467014 8:69140128-69140150 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1042602807 8:70515099-70515121 ATTTCCTTTGAAAAGAGGGGAGG - Intergenic
1043064593 8:75551877-75551899 CTTTCCTTGAAAATGACTTCTGG + Intronic
1043071604 8:75642921-75642943 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1043816772 8:84811982-84812004 ATTTACCTGAAAAAGGGTTCAGG - Intronic
1044514051 8:93117960-93117982 ATGTCATAGAAAAAGAGGACAGG + Intergenic
1045779937 8:105850484-105850506 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1045874394 8:106962147-106962169 ATTTCCTAGGAAAAGTGGTTAGG - Intergenic
1046074519 8:109300259-109300281 ATTTACCTGAAAAAGAATTCAGG + Intronic
1046498881 8:115049393-115049415 ATTTCCTTGAATAAGGTCTCTGG - Intergenic
1046599565 8:116300453-116300475 ATCTGCATGAAAAGGAGGTCGGG + Intergenic
1046604820 8:116359686-116359708 ATTTCCATGAAGCAGGGGTCTGG + Intergenic
1049295872 8:141837357-141837379 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1050147493 9:2584333-2584355 ATTTACTTGAAAAATAATTCAGG + Intergenic
1050502804 9:6315982-6316004 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1051143731 9:14005393-14005415 AATTCCAAGAAATAGAGGTCAGG - Intergenic
1051362788 9:16295573-16295595 ATTTACCTGAAAAAGAGTTCAGG + Intergenic
1052731347 9:32290554-32290576 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1053121329 9:35549182-35549204 ATTTCCTGGAAGAAAAGTTCAGG + Intronic
1053490395 9:38496490-38496512 ATTTCCTTGATAGAGAATTCTGG + Intergenic
1054867674 9:70019725-70019747 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1055368958 9:75576184-75576206 ATTTACTTGAAAAAATGGTAAGG + Intergenic
1055905696 9:81291761-81291783 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
1056322614 9:85451383-85451405 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
1056849443 9:90069985-90070007 ATTTCCCTGAAAGAAATGTCAGG + Intergenic
1057670721 9:97085745-97085767 ATTTCCTTGATAGAGAATTCTGG + Intergenic
1057874147 9:98740604-98740626 ATTTCCTGAGAAATGAGGTCAGG + Intronic
1058156614 9:101523717-101523739 ATTTACCTGAAAAAGAATTCAGG - Intronic
1058561694 9:106235877-106235899 ATATACATGAAAAAGAGGTGAGG - Intergenic
1058597384 9:106629709-106629731 ATGTGTTTGAAAATGAGGTCAGG - Intergenic
1058918960 9:109594962-109594984 ATATCCTTGAGAGAGAGGACAGG - Intergenic
1059420659 9:114189512-114189534 ATTTCCTTGAAAAAACGCTTGGG + Intronic
1203527830 Un_GL000213v1:106115-106137 ACTTGCTTAAAAAAGAAGTCTGG - Intergenic
1187699535 X:21951795-21951817 ATTTCTTTGAACAAAGGGTCTGG + Intronic
1187773494 X:22729824-22729846 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1188045778 X:25425341-25425363 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1188144064 X:26587697-26587719 ATTTCCTTGAAAAAGTGGGGAGG + Intergenic
1188379485 X:29473528-29473550 ATATCTTTTAGAAAGAGGTCTGG - Intronic
1188737892 X:33741405-33741427 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1189987829 X:46569875-46569897 ATTGCCAGGAAAAAGAGTTCAGG + Intergenic
1190594129 X:52036060-52036082 ATTTCCTTTAAGATGAGTTCAGG - Intergenic
1190845134 X:54183803-54183825 TTTTCCTGGAAAAAGAGTTTTGG + Intergenic
1190895362 X:54613416-54613438 ATTTATCTGAAAAAGAGTTCAGG - Intergenic
1191080745 X:56506766-56506788 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1191954236 X:66626173-66626195 ATTTACCTGAAAAAGAATTCAGG + Intronic
1192820330 X:74637811-74637833 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1192860777 X:75068136-75068158 TTTTCAGTGAAAAAGAGGACAGG + Intronic
1192968073 X:76201662-76201684 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1193062846 X:77224180-77224202 ATTTACCTGAAAAAGAACTCAGG + Intergenic
1193156972 X:78184010-78184032 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1193253287 X:79318791-79318813 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1193420919 X:81280828-81280850 ATTTACCTGAAAAAGAATTCAGG + Intronic
1193437977 X:81502570-81502592 ATTTACTTGAAAAAGAATTCAGG - Intergenic
1193512271 X:82417650-82417672 ATTTCTTTGAAAAAGTTTTCTGG - Intergenic
1194336346 X:92651095-92651117 AATTTCTTTAAAAAGAGATCAGG + Intergenic
1194701372 X:97119034-97119056 ATTTACCTGAAAAAGAATTCAGG - Intronic
1194926803 X:99835835-99835857 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1195075996 X:101327385-101327407 ATTTACCTGAAAAAGAATTCGGG + Intergenic
1195795571 X:108642918-108642940 ATTTACCTGAAAAAGAATTCAGG + Intronic
1196225069 X:113157194-113157216 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1196254345 X:113498444-113498466 ATGTCCTTATAAAAGAGATCTGG + Intergenic
1196675637 X:118418169-118418191 ATTTACCTGAAAAAGAATTCAGG - Intronic
1196882868 X:120214909-120214931 ATTTTCTTGCAAGACAGGTCTGG - Intergenic
1196897516 X:120352139-120352161 ATATCCTTGAAAAGGTAGTCTGG - Intergenic
1197066123 X:122236583-122236605 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1197102587 X:122673664-122673686 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1197132519 X:123020828-123020850 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1197476206 X:126928926-126928948 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1197519029 X:127473858-127473880 ATTTGCCTGAAAAAGAATTCAGG + Intergenic
1197589021 X:128384912-128384934 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1197671530 X:129283680-129283702 ATTTACCTGAAAAAGAATTCAGG - Intergenic
1198606172 X:138340440-138340462 ATTTCCTGAAAAAAGAGCCCAGG + Intergenic
1199057727 X:143318372-143318394 ATTTGCCTGAAAAAGAATTCAGG - Intergenic
1199248349 X:145631944-145631966 ATTTCCTTGCAAAAGGGTTAAGG + Intergenic
1199545188 X:149001158-149001180 GTTTCCTTCAAAAAGATTTCTGG + Intergenic
1199668650 X:150121953-150121975 ATTTACCTGAAAAAGAATTCAGG + Intergenic
1200644776 Y:5767845-5767867 AATTTCTTTAAAAAGAGATCAGG + Intergenic