ID: 915790665

View in Genome Browser
Species Human (GRCh38)
Location 1:158666811-158666833
Sequence TTTGAATTTCCTTGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915790665_915790668 14 Left 915790665 1:158666811-158666833 CCTCTTTTTCAAGGAAATTCAAA 0: 1
1: 0
2: 3
3: 48
4: 441
Right 915790668 1:158666848-158666870 TTTCTAGGAGAAGCATAATGAGG 0: 1
1: 0
2: 1
3: 22
4: 215
915790665_915790669 18 Left 915790665 1:158666811-158666833 CCTCTTTTTCAAGGAAATTCAAA 0: 1
1: 0
2: 3
3: 48
4: 441
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191
915790665_915790666 -1 Left 915790665 1:158666811-158666833 CCTCTTTTTCAAGGAAATTCAAA 0: 1
1: 0
2: 3
3: 48
4: 441
Right 915790666 1:158666833-158666855 ATCCAAACACTCTATTTTCTAGG 0: 1
1: 0
2: 1
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915790665 Original CRISPR TTTGAATTTCCTTGAAAAAG AGG (reversed) Intronic
901927557 1:12576152-12576174 CTTGAATTTCCTTCTTAAAGTGG + Intronic
903852203 1:26314805-26314827 TTTGAGTTTCCTAGGGAAAGTGG + Intronic
904243361 1:29166542-29166564 TTTGACTTTCCTGGCAACAGAGG + Intronic
905550461 1:38833829-38833851 TTTGCTTTTCTTTAAAAAAGAGG - Intergenic
907215622 1:52861420-52861442 TTTGCAATTCCTTAAAAATGTGG + Intronic
907894151 1:58668499-58668521 TTTTAGATTCCTTGTAAAAGAGG + Intronic
908398171 1:63745436-63745458 TTTGCATTTCCTTCTAATAGTGG + Intergenic
908622573 1:66000889-66000911 TTGGAGATTCCTCGAAAAAGAGG + Intronic
909877940 1:80834236-80834258 TCTGATTTTGCTTGAAGAAGAGG - Intergenic
909921639 1:81388596-81388618 AGTGAATGTCCTTGTAAAAGAGG + Intronic
911811055 1:102282485-102282507 TTAGAAAATCCTAGAAAAAGGGG - Intergenic
911841814 1:102692586-102692608 TTTGAAATTCCTTGAATACAAGG - Intergenic
911978238 1:104530740-104530762 TTTGTATTTATTTGAAAAAACGG + Intergenic
912130341 1:106591687-106591709 TTTCAATTTTCTTGATAAAGTGG - Intergenic
912310815 1:108619355-108619377 TTCAAATGTCATTGAAAAAGGGG + Intronic
912310893 1:108620217-108620239 TTTAAATTTACTTGAGAAACAGG + Intronic
913039481 1:115008633-115008655 TTTGAAGTCCCTTGATAAATGGG + Intergenic
913400678 1:118429434-118429456 AATCAATCTCCTTGAAAAAGTGG + Intergenic
914795679 1:150918295-150918317 TTTAAATTCACTTGAAAAATGGG + Intergenic
915790665 1:158666811-158666833 TTTGAATTTCCTTGAAAAAGAGG - Intronic
916510059 1:165465469-165465491 TATTAATTTTTTTGAAAAAGAGG - Intergenic
917470265 1:175320582-175320604 TTTCAACTTCCTTGATGAAGTGG + Exonic
917474281 1:175354906-175354928 TATGATTTCCCTTTAAAAAGAGG + Intronic
918635952 1:186774408-186774430 TTTGTTTTTCCTGGAAGAAGAGG + Intergenic
918733609 1:188031100-188031122 TTTGAATCTGGTTTAAAAAGAGG - Intergenic
919108767 1:193190401-193190423 TTTGACTTCTCTTCAAAAAGGGG - Intronic
919546508 1:198927424-198927446 CTAGATTTTCCTTTAAAAAGGGG - Intergenic
920417347 1:205807605-205807627 TTTGTCTTTCCTTGAAGAACTGG - Intronic
922026973 1:221759149-221759171 TTTGCCTTTCCTATAAAAAGAGG - Intergenic
923930869 1:238695042-238695064 TATGAAATTCCTAGAAAAAATGG + Intergenic
1063826472 10:9904117-9904139 TTTGAGTTTCCTAGCAAAAACGG - Intergenic
1064111601 10:12544089-12544111 TTTGATTTTCTTTGAAATATGGG + Intronic
1066217753 10:33304445-33304467 TTTGAAAACCCTTGAAAGAGGGG - Intronic
1066817520 10:39438675-39438697 CTTGAATTTTCTACAAAAAGAGG + Intergenic
1068358474 10:55943394-55943416 TTTCAATTTCCTTTGAACAGAGG + Intergenic
1068956764 10:62825377-62825399 TTTGAATTTCATGAAACAAGCGG + Intronic
1069608794 10:69758353-69758375 TTTGAATGGCCATGAAAAATAGG - Intergenic
1070221208 10:74447431-74447453 TATGAATTTCCTTTACAAAAGGG + Intronic
1070354581 10:75627288-75627310 GTTGAATTTCCTGAACAAAGTGG + Intronic
1070408651 10:76119151-76119173 TTTGACATTTCTTGTAAAAGAGG + Intronic
1070849308 10:79550811-79550833 TTTGAATTTTCTTTAATAGGAGG - Intergenic
1070924539 10:80210208-80210230 TTTGAATTTTCTTTAATAGGAGG + Intergenic
1071749304 10:88456764-88456786 TTTGAATTTTTTTAAAAAATTGG - Intronic
1071874685 10:89832336-89832358 TTTTAATTTCCTTTAAAATTAGG - Intergenic
1072902220 10:99418671-99418693 TTTGTATTTCCTTGTAGAAACGG + Intronic
1074286467 10:112102601-112102623 ATTGAAGTTCCTGGGAAAAGTGG + Intergenic
1074350464 10:112732032-112732054 TTTTAATTAGCTTGAAAAAAAGG - Intronic
1074740017 10:116477416-116477438 TTGGAATTTTCCTGAATAAGAGG + Exonic
1074754496 10:116614418-116614440 TGTGAATGTCCTTATAAAAGAGG + Intergenic
1074799491 10:116984982-116985004 GTTGAATTGCTTTGAAAAAGAGG - Intronic
1074833534 10:117266909-117266931 TTTGATTTTCATTGAAAATTTGG + Intronic
1075234969 10:120719567-120719589 TTTGAAGTTTCTTGTAAATGTGG - Intergenic
1075795712 10:125118116-125118138 TTTTATTTTTCTTTAAAAAGTGG - Intronic
1075988516 10:126810830-126810852 TTTAAATTAAGTTGAAAAAGAGG + Intergenic
1076129217 10:128001460-128001482 TTTAAATTTCCATTAAAATGGGG - Intronic
1076635377 10:131878929-131878951 TGTGACTTTACTTGGAAAAGGGG - Intergenic
1079702123 11:23561302-23561324 TGTGAATTTACTTGAAAATGCGG + Intergenic
1079768068 11:24419592-24419614 TCTCAAATTCATTGAAAAAGAGG - Intergenic
1080333195 11:31165765-31165787 TTTGAATTTCTTTGATGAGGAGG + Intronic
1080390230 11:31839015-31839037 TTTCTATTTCCATGAAAAGGTGG - Intronic
1083026730 11:59557587-59557609 TTTAAATTTCCTTGACAGGGCGG - Intergenic
1084292904 11:68187166-68187188 TTTGTATTTTTTTGTAAAAGTGG + Intronic
1084717348 11:70882432-70882454 ATTGATTTTCCTTGATAAAATGG + Intronic
1086230684 11:84566422-84566444 TTTGCATTTCCTTAGAAGAGTGG + Intronic
1086529768 11:87770977-87770999 TTTGAATATCATTAAAAGAGTGG - Intergenic
1086749427 11:90472686-90472708 TTTGAATATCCTGGAAATAGAGG - Intergenic
1086833215 11:91592197-91592219 TTTGAATTTACTTTAAACTGGGG + Intergenic
1086853318 11:91837433-91837455 TTTGAAATTCTTTCAAAAAGAGG + Intergenic
1087042796 11:93818430-93818452 TTTCCATTTCTTTGAAAAAAGGG - Exonic
1089010022 11:115124556-115124578 TTTGCATTTCCTTGACACACAGG + Intergenic
1090980834 11:131720124-131720146 TTTCAATTGCTTTGTAAAAGAGG - Intronic
1092007502 12:5081709-5081731 TTAGTATTTCCTTGCAAATGTGG - Intergenic
1092276341 12:7063945-7063967 TTTGAACTTGCTTGAAAATGTGG + Intronic
1093365007 12:18283685-18283707 TTTGAATTCACTTGCAAAAGAGG + Intronic
1093631644 12:21417468-21417490 TTAGATTTTCTTTTAAAAAGAGG + Intronic
1094253200 12:28390580-28390602 TTTGGTTTTCCTTGAAACAGTGG + Intronic
1094799229 12:34011703-34011725 TGTGAATTACTTTGAAAGAGGGG + Intergenic
1094874747 12:34628092-34628114 ATTGAAATTCTTTTAAAAAGAGG - Intergenic
1095062425 12:37714464-37714486 ATTGCATTTCCTACAAAAAGAGG - Intergenic
1095112009 12:38305977-38305999 TGTGAATTACCTTGAAAGAGGGG + Intergenic
1095182056 12:39157652-39157674 TTTGATTTTATTTAAAAAAGAGG + Intergenic
1095276116 12:40284415-40284437 TTTATATTTCCTTTAAAAACAGG - Intronic
1097555483 12:61132391-61132413 TTCCAATTTCTATGAAAAAGAGG + Intergenic
1097951279 12:65431244-65431266 TTTCAATTTTCTTGAAAAACAGG - Intronic
1098524728 12:71473655-71473677 TTAGAATTTGGTTTAAAAAGAGG + Intronic
1098859928 12:75697198-75697220 CTTAAATTTACTTGAAAATGAGG - Intergenic
1099072037 12:78057037-78057059 TTTGAATTTACTTTAAACACTGG + Intronic
1099121375 12:78693612-78693634 CATGAATTTCCTTGAAAAACAGG - Intergenic
1099321649 12:81158259-81158281 TATGAATTTGTTTGAAAATGTGG - Intronic
1099640866 12:85281505-85281527 TTTGAATTTCTATAAAATAGGGG - Intronic
1099661066 12:85562734-85562756 TTTGAATTTTAATGAAAAAAGGG - Intergenic
1099924867 12:89005043-89005065 TGTTAATTTCCTAGAAGAAGTGG + Intergenic
1100903282 12:99268312-99268334 TATGAGTCCCCTTGAAAAAGGGG + Intronic
1100917488 12:99442178-99442200 ATCAAATTTCCTTGAAAAAGAGG + Intronic
1101779956 12:107826246-107826268 ATTAAAATTCTTTGAAAAAGAGG - Intergenic
1102214720 12:111152544-111152566 TTTAATTTTCCTTTAAAAATGGG - Intronic
1107020096 13:35742452-35742474 TGTAAATTTCCTTTACAAAGGGG - Intergenic
1107347950 13:39483206-39483228 TTTGAACTTACATTAAAAAGAGG + Intronic
1107422436 13:40261038-40261060 TTTTGCTTTCCTTGATAAAGGGG - Intergenic
1107448924 13:40491404-40491426 CTTGAATTTCCTTGGATAGGTGG + Intergenic
1107520896 13:41179969-41179991 TTTGAATTTTCATGTCAAAGGGG + Intergenic
1107752469 13:43583449-43583471 TTTGACTGTCATTGAAATAGTGG - Intronic
1108975263 13:56434549-56434571 TATGAATTTCCTACTAAAAGTGG - Intergenic
1109425922 13:62166410-62166432 TTAGAATTGCCTTGATAAACTGG - Intergenic
1109466069 13:62733069-62733091 TGTGAACTTCCCTGAAAAAATGG - Intergenic
1109842319 13:67935410-67935432 TTTGAACTTCTTTAAAAAAATGG - Intergenic
1109928182 13:69175327-69175349 TTTGTATTTCATGTAAAAAGTGG - Intergenic
1110038178 13:70715790-70715812 TTTGAATTTTTTTTAAAAAATGG + Intergenic
1110042380 13:70779625-70779647 TATTATTTTCCTTGAAAAATAGG - Intergenic
1110591059 13:77259731-77259753 TTTGAGTTTCTTTGTAAAAAAGG - Intronic
1112975972 13:105318005-105318027 TTTGTATTTCTGTGATAAAGGGG - Intergenic
1114500127 14:23162390-23162412 TTTCAATGTCCTTGAAATATGGG - Intronic
1114947328 14:27700364-27700386 TTAAAATTTCCTTGCAGAAGTGG + Intergenic
1114976612 14:28108537-28108559 TTTGAATTAACTTGCAAAATAGG - Intergenic
1114980193 14:28154373-28154395 TAGAAATGTCCTTGAAAAAGGGG - Intergenic
1115054762 14:29110144-29110166 TTTGAACTGCATTAAAAAAGAGG - Intergenic
1115396031 14:32909523-32909545 ATTCAATTTCCCTGAAAAAATGG - Intergenic
1115952631 14:38738027-38738049 TCTGAAATTCCATGAGAAAGAGG + Intergenic
1115978748 14:39025715-39025737 TTTAAATTGCCTTGAAGAAAAGG + Intergenic
1116507922 14:45708257-45708279 TTTGTATTTCCTAGAAAATTCGG + Intergenic
1117116751 14:52521681-52521703 TTTACATTTCTTTTAAAAAGTGG - Intronic
1117254940 14:53968182-53968204 TTTGAATTTACATGCAAAAAGGG + Intergenic
1117562050 14:56950649-56950671 TTTGATTTCCCATGAAAAAGTGG + Intergenic
1119173549 14:72552734-72552756 TTTGAAATTCCTTGATAAACCGG + Intronic
1119364902 14:74083813-74083835 TTTGAATTTCCTTCTAGAGGTGG - Intronic
1119991744 14:79205857-79205879 TTTGAAGTTCCTTGAAATAGAGG - Intronic
1120497509 14:85255240-85255262 ATTGTATTTCTTTGAAAAACTGG + Intergenic
1120618998 14:86739694-86739716 TTTGGGTTTCCTTGGCAAAGAGG + Intergenic
1120725781 14:87939038-87939060 TTTGTATTTCCTTGATAATTAGG - Intronic
1120762215 14:88295372-88295394 TTTAAATTTCCTTGAGATGGTGG + Intronic
1121077141 14:91078332-91078354 ATTGAGTTTCCCTGAAAAACTGG + Intronic
1121810321 14:96881549-96881571 TTTGCATTTCCTTAAAAGTGAGG - Exonic
1122452375 14:101820045-101820067 TTTAAAGTTCCTGGAAAAAGTGG - Intronic
1122506084 14:102232670-102232692 TTTGATTTTCCTTTTAAAAAGGG - Exonic
1123400763 15:19983275-19983297 TTTGAATTCCCCTGATAATGAGG - Intergenic
1124412464 15:29447754-29447776 TTTAAATTTACTTTAAAAAATGG + Intronic
1125145229 15:36459739-36459761 CATGAATTTCCTTGAGAAACAGG - Intergenic
1125702762 15:41702596-41702618 TTTGAATTTGCTTTAAAATTGGG + Intronic
1126042520 15:44606186-44606208 CTTAAATTGCCTTGGAAAAGGGG - Intronic
1126628550 15:50710073-50710095 TTTTAAATTCCTAGAAGAAGAGG - Intronic
1127605690 15:60585585-60585607 CTTGAATATCTTTTAAAAAGAGG - Intronic
1127841756 15:62837977-62837999 TTGGAATTTTCTTCTAAAAGTGG - Intronic
1127925639 15:63537999-63538021 TTTTAGTATCCTTTAAAAAGAGG + Intronic
1127975289 15:63992661-63992683 GATGTATTTCCTTGAGAAAGTGG - Intronic
1127986288 15:64073991-64074013 TTTGCATTTCCTTGACTAATAGG + Intronic
1127986313 15:64074455-64074477 TTTGAAATTCCTTGAATGATAGG - Intronic
1129257716 15:74343577-74343599 TTAGATTTTTCTGGAAAAAGAGG - Intronic
1130022913 15:80245926-80245948 TTTGATTTTCATTACAAAAGTGG - Intergenic
1130954670 15:88619266-88619288 TGTGAATTGCCTTTGAAAAGTGG + Intergenic
1135869805 16:26138835-26138857 TTAAAATTTCCTGGAGAAAGAGG + Intergenic
1136243097 16:28956592-28956614 TTTTTTTTTCCTTCAAAAAGTGG + Intronic
1137377607 16:47966615-47966637 TTTGAATTTCAAAGTAAAAGAGG - Intergenic
1138079822 16:54079818-54079840 TTTGACTCTGCTTGAAAAATGGG - Intronic
1139221737 16:65189562-65189584 TGTCAATTTCCTTGAAAACAAGG + Intergenic
1140096168 16:71877428-71877450 TTTGTATTTTTTTGAAAAAACGG + Intronic
1140610301 16:76590746-76590768 TTTAAATTTTCTTTAAAAATGGG - Intronic
1143313985 17:6017457-6017479 TTTAGATTTCCTTAGAAAAGAGG - Intronic
1143531699 17:7508860-7508882 TTTGGATTCCCTTGATAAGGAGG + Intronic
1143804500 17:9415181-9415203 TTTGAAGATGCTAGAAAAAGAGG - Intronic
1144289682 17:13814601-13814623 TTTAAAAATCCTTTAAAAAGAGG + Intergenic
1147653114 17:42072999-42073021 CCTGAGTTTCCTTGCAAAAGAGG - Intergenic
1149962675 17:61129238-61129260 TATGAATTTCTTTGAAGTAGAGG + Intronic
1151735753 17:75939352-75939374 TTTGAGATTACTTGAAAAAAGGG + Intronic
1151861691 17:76768595-76768617 TTTTCTTTTCCTAGAAAAAGGGG + Intronic
1151881204 17:76895905-76895927 TTTGAATTTCTTTAAAAATCGGG - Intronic
1152165087 17:78698670-78698692 TGTGAATTTCATTAAGAAAGTGG - Intronic
1153145769 18:2029892-2029914 CTTGAATTCTCTTGAAAAAGTGG - Intergenic
1153526081 18:5995905-5995927 TTTCAATTTCCATGAAAAAAGGG + Intronic
1155333399 18:24740526-24740548 TATAAATTTCCTTTAAAAAAGGG - Intergenic
1156600024 18:38594900-38594922 TCTGAATTTCCATGAAATAGTGG - Intergenic
1157101745 18:44736807-44736829 TTTGCAGTTCTTTGGAAAAGAGG + Intronic
1157323531 18:46652470-46652492 TTTGCATTTCCCTGATAAATAGG - Intronic
1157354270 18:46918282-46918304 GTTCAATTTCCTTGAAGAATTGG + Intronic
1157770270 18:50339560-50339582 TTAGAAGTTCCTTGAAAACAGGG + Intergenic
1158106518 18:53890747-53890769 GTTGAATTTCCATAAGAAAGTGG + Intergenic
1158257575 18:55570562-55570584 TTTGCATTTCCTTGATAATTCGG - Intronic
1158378161 18:56897068-56897090 TTTGCATTTCCTTGACAATAGGG - Intronic
1159023137 18:63159270-63159292 TCTGATTTGCCTTGAAAAGGGGG + Intronic
1159666367 18:71166503-71166525 TTTGATTTTACTTAAGAAAGAGG - Intergenic
1159985596 18:74837013-74837035 TCTGAATTTCCTTCCAGAAGAGG + Intronic
1163333770 19:16658596-16658618 TCTGATTTTTCTTGAAAAATTGG - Intronic
1164638186 19:29806644-29806666 TTTGAAGATGCTTGAAAGAGTGG - Intergenic
1164926895 19:32137715-32137737 CATGAACTTCATTGAAAAAGTGG - Intergenic
1165715226 19:38040656-38040678 TTTGAATTTTTTTTAAAAAAAGG - Intronic
1166722328 19:45003712-45003734 TCTCAATTTCCCTGAAAGAGAGG - Intronic
925483987 2:4307778-4307800 TTTAAAGTTCCTTGAAACAAAGG - Intergenic
925531346 2:4866124-4866146 GTTAAATTCCCTTGAAAAACAGG + Intergenic
925767063 2:7246524-7246546 TTTAATTTTCCTGTAAAAAGTGG - Intergenic
926571187 2:14531566-14531588 TTTCAATTACATTGAAAATGAGG + Intergenic
926627620 2:15105960-15105982 ATTGAATTTACTTGAACAACGGG + Intergenic
928746119 2:34418060-34418082 ATTGTATTTCATGGAAAAAGTGG - Intergenic
929167722 2:38900514-38900536 TTTGAATTACTCTGAAATAGAGG + Intronic
929199851 2:39223514-39223536 TTTGAATTTCCTTGATTAATAGG + Intronic
929818210 2:45252948-45252970 TTATAATTTCCTGGAAGAAGTGG - Intergenic
930403033 2:50915228-50915250 TTAGCTTTTCCTTGAAAATGTGG + Intronic
931071594 2:58657741-58657763 TTTCCATTTCCTTGAGAAACAGG - Intergenic
931610422 2:64093022-64093044 ATTACATTTCTTTGAAAAAGGGG + Exonic
931815787 2:65899213-65899235 TTTGAATTCACTGGGAAAAGTGG + Intergenic
932315981 2:70783316-70783338 CTGGAATTTCCTTCAAAAAAGGG - Intronic
933331809 2:80901713-80901735 TTTGAATTTCCTAGACATAATGG - Intergenic
933437877 2:82271601-82271623 TTTTTCTGTCCTTGAAAAAGTGG + Intergenic
933478732 2:82825909-82825931 TTTTAAGGTCCTTGACAAAGTGG - Intergenic
933613481 2:84460558-84460580 TTTGTATTTCCATGAAGACGGGG + Intergenic
933650428 2:84845883-84845905 TTTCATTTTACCTGAAAAAGGGG + Intronic
934016670 2:87893670-87893692 TTTGAATTTGATTGAATAACTGG - Intergenic
935350218 2:102146021-102146043 TTTAAAGATCCCTGAAAAAGAGG + Intronic
936635203 2:114248455-114248477 TTTGGTTTTCCAGGAAAAAGTGG + Intergenic
936704452 2:115055439-115055461 TTTCACTTTGTTTGAAAAAGTGG + Intronic
937121683 2:119443969-119443991 TTTGAATTTACTTAAAAAGATGG + Intronic
938225183 2:129609721-129609743 TTGGAATTATGTTGAAAAAGAGG + Intergenic
938487815 2:131731690-131731712 TTTTCATCTCCCTGAAAAAGGGG - Intronic
939046221 2:137252795-137252817 TCTGAATTCCCTCCAAAAAGTGG - Intronic
939117525 2:138077493-138077515 TTTAAATTTTCTGGAGAAAGAGG + Intergenic
939338087 2:140857138-140857160 TTTGAATTTATTGGAAAAACTGG - Intronic
939641189 2:144641945-144641967 ATTGTATTTCCCTGAAAGAGAGG - Intergenic
939824140 2:146994348-146994370 TTTGAATTTCATAGCATAAGGGG - Intergenic
940436066 2:153656807-153656829 TTTGGACTTCCTTGAGAAAGTGG + Intergenic
941222108 2:162795402-162795424 ATTGAATGTCCTTTAAAAAGAGG - Intronic
942402336 2:175616237-175616259 TGTGAGTTTCCTTAAAAATGTGG + Intergenic
942456526 2:176141895-176141917 TGTTAATTTCTTTGAAAAGGAGG + Intergenic
943158609 2:184217022-184217044 TTTGAATTGCCTTGAGTATGTGG + Intergenic
943592650 2:189817555-189817577 TTTGAATGTTGTTGAAAATGAGG + Intronic
944019217 2:195080797-195080819 CTTGAATTTCCTTAACAAATAGG - Intergenic
944152103 2:196570769-196570791 TCTGATTTTTCTTGAAAAATTGG + Intronic
944385778 2:199163091-199163113 TTTGCATTTCCTGGAACATGAGG + Intergenic
945193495 2:207215355-207215377 TTTTAATTTCTTTGCAAAATGGG - Intergenic
945424498 2:209683275-209683297 TTTGAATTACTTTCAATAAGAGG - Intronic
945732847 2:213562406-213562428 TTTGTATTTTCCAGAAAAAGAGG - Intronic
945757476 2:213866471-213866493 TTGGAAGTTACTTTAAAAAGTGG + Intronic
945783065 2:214201314-214201336 TTTTAATTTACTTGTAATAGGGG + Intronic
946645033 2:221824149-221824171 TTTGTATTTGGTTGAAAGAGAGG + Intergenic
946866387 2:224044618-224044640 TTTGAACTGACTTGAAAAAATGG - Intergenic
948956396 2:241295665-241295687 TTTTACTTTTCTTGGAAAAGGGG + Intronic
1169499188 20:6142835-6142857 TTTGAATTGAGTTGAAAAAGGGG + Intergenic
1169639924 20:7740531-7740553 TTTAAATTTCCTGGCAGAAGAGG - Intergenic
1169707467 20:8521837-8521859 TTTACCTTTTCTTGAAAAAGTGG - Intronic
1170676942 20:18490983-18491005 TTTCAACTACCTTGAAAAATGGG - Intronic
1170677744 20:18497990-18498012 TTTGAATTTTCTGGAAACATTGG + Intergenic
1170926378 20:20728333-20728355 GTTGAATTTCTTTTAAAAAGGGG + Intergenic
1171263077 20:23749931-23749953 TTTGAATTTCCAGGAGAAGGTGG + Intronic
1171266369 20:23775213-23775235 TTTGAATTTCCAAGAGAAGGTGG + Intergenic
1171272170 20:23825804-23825826 TTTGAATTTCCAAGAGAAGGTGG + Intronic
1171885646 20:30650317-30650339 TATGATTTACTTTGAAAAAGAGG + Intergenic
1172211770 20:33204441-33204463 TCTCAAATTCCTTGCAAAAGAGG - Intergenic
1172588954 20:36104373-36104395 TTAGAATTTCCCTGCAGAAGGGG + Intronic
1174716949 20:52769131-52769153 TGTGAACTTCCTTTAAAAAAAGG + Intergenic
1175709401 20:61207012-61207034 TCAGAATTTCCTAGAAAAAGAGG + Intergenic
1178135323 21:29620471-29620493 TTTAAACTTCATTGAAATAGAGG + Intronic
1178150874 21:29792233-29792255 TTTGAATTTACTGGAATAAGAGG + Intronic
1178213824 21:30569959-30569981 TTTGAGTTTTCTTTAAAAACAGG + Intergenic
1178249601 21:30989574-30989596 TTTGCAGTTCCTTGAGAAAGAGG - Intergenic
1180629393 22:17217524-17217546 TTTGAATTACATTTAAGAAGGGG + Intronic
1182864587 22:33592450-33592472 TTTGATTATCCTGGAAAAAAGGG - Intronic
949336778 3:2983436-2983458 TTTGTAATTGCTTGAAACAGTGG + Intronic
951176613 3:19608989-19609011 TTTTAAATTTCATGAAAAAGTGG + Intergenic
951464107 3:22983301-22983323 GGTGAATTTCCTTGACAAGGAGG - Intergenic
951715674 3:25642914-25642936 TTCAAATTTCCTTGAAGCAGTGG - Intronic
951868301 3:27332347-27332369 TTTGATTTTGCAAGAAAAAGAGG + Intronic
952447408 3:33395235-33395257 TTTGAATTTTACTGAAAAATTGG - Intronic
952595613 3:35014146-35014168 TTTTTATTTACTTTAAAAAGTGG + Intergenic
952713838 3:36458171-36458193 ATTGAATTTCCTGGAAAACTTGG + Intronic
952832815 3:37579178-37579200 TTTGACTTGGCTTGAAAGAGTGG - Intronic
955242034 3:57186763-57186785 TTTGACCTTCCTTTAAAATGGGG + Intergenic
956190251 3:66601233-66601255 TATGTATGTCCTTGGAAAAGGGG + Intergenic
956526619 3:70170190-70170212 CTTGAATTTCATTGAGAAAATGG + Intergenic
956968842 3:74497032-74497054 TTTGGATTGCCTTTAACAAGTGG + Intronic
957205271 3:77190033-77190055 TTTTCATCTCCATGAAAAAGAGG + Intronic
958000517 3:87743216-87743238 TTTGGCTTTCCATGAGAAAGTGG - Intergenic
958777225 3:98500525-98500547 ATTGACTTTTCTTGAAAAAGTGG + Intronic
959400320 3:105892900-105892922 TTTGAATATTCTTTAAAAATGGG - Intergenic
959444099 3:106416074-106416096 TTTGAAGTTCCTTGAGAAAAAGG + Intergenic
959480991 3:106872457-106872479 TTTGAAATTCTTTGGAAAAGGGG - Intergenic
959481260 3:106875178-106875200 TTTGAAATTCTTTGGAAAAGGGG + Intergenic
959679595 3:109079011-109079033 TTAGAACTTCCTTGAAAATCTGG - Intronic
960228894 3:115201258-115201280 TCTGAACTTCCTTGAAAAAAAGG + Intergenic
960457676 3:117893043-117893065 TTTAAATTTTCTTTAAAAAAAGG - Intergenic
961334919 3:126168972-126168994 TTTGAATTATCTTCAAAACGTGG + Intronic
962071644 3:132039759-132039781 TTTGCATTTTCCTGGAAAAGAGG + Exonic
962081895 3:132148839-132148861 TCTGACTTTCCTTGACGAAGAGG - Intronic
962173077 3:133123692-133123714 TTTGAATTTCTTCTAAAAAGAGG - Intronic
962587617 3:136858593-136858615 TTTGAGTTCCCCTGAAAGAGAGG + Intergenic
963263892 3:143220092-143220114 TTTCCCTTTCCTTGATAAAGTGG - Intergenic
964133845 3:153321713-153321735 TTTGAATTCTCTTGAGAAGGTGG - Intergenic
965027509 3:163321075-163321097 TTTTAATTTTCTTTAAAAAATGG + Intergenic
965251370 3:166348500-166348522 TTTCAAGTTCCTTGATAAATGGG + Intergenic
965273104 3:166644503-166644525 TTCTACTTTCCTTTAAAAAGGGG + Intergenic
966253137 3:177889162-177889184 TTTGAATTTCCTGACAAATGAGG - Intergenic
966324603 3:178740006-178740028 TCTGCATTTTCTTGAAAAATAGG - Intronic
967559407 3:190901011-190901033 ATTGAAGTTTCTTCAAAAAGGGG - Intergenic
968784711 4:2611629-2611651 TTTGTATCTCTTTGGAAAAGTGG + Intronic
968851407 4:3082197-3082219 TTAGAATTTCTTTTTAAAAGAGG + Intronic
971545954 4:27887171-27887193 TTTGGATATCGTTGAAACAGTGG - Intergenic
971910022 4:32783852-32783874 TTAGAATTTTCTTGAGACAGTGG + Intergenic
972378463 4:38495924-38495946 TTTTAATTTTCTGGAAAATGTGG + Intergenic
973016501 4:45145778-45145800 TTTACATATCCTTGCAAAAGGGG - Intergenic
973059421 4:45702095-45702117 TTTACATTTCATTAAAAAAGGGG + Intergenic
973944467 4:55942988-55943010 TTTGAATTTCCTGGAAGACAGGG - Intergenic
974451780 4:62072156-62072178 AGTGAATTTCCTCTAAAAAGTGG - Exonic
974730211 4:65854045-65854067 TTTACCTTTCCTTGGAAAAGTGG + Intergenic
974789569 4:66669918-66669940 TTGGGATTTCCTTGGAAAATAGG - Intergenic
976222421 4:82767937-82767959 TATTATTTTCCTTCAAAAAGAGG - Intronic
976600114 4:86930496-86930518 ATTTAATCTCCTTGAAAATGTGG - Intronic
976731402 4:88265990-88266012 TTAGATTTTCCTTGAAAAATGGG + Intronic
976858451 4:89631900-89631922 TTGGACTTTATTTGAAAAAGAGG + Intergenic
977407516 4:96618725-96618747 TTTGAATTTCCAAGATAAAGGGG + Intergenic
977700224 4:100013685-100013707 CTTGAATTTCATTGAATTAGAGG + Intergenic
977773044 4:100882074-100882096 TTTGATTTGCCATGAAAATGGGG + Intergenic
977883344 4:102231952-102231974 TTAGAATTTCCCTGTCAAAGAGG + Intergenic
978012009 4:103699091-103699113 TTAGAATTTCCATGAAAACAAGG - Intronic
978015626 4:103742232-103742254 TTTTAATTTTCTTGAAAAATTGG + Intergenic
978294187 4:107183988-107184010 TTTTAATTTTCTTAAAAAAAGGG + Intronic
978339691 4:107709223-107709245 TTTGATTTACTTTGAAAAATTGG - Intronic
978401052 4:108331292-108331314 TTGAAAGTTCCTTGAAAAAGTGG - Intergenic
978734915 4:112075024-112075046 ATTGAATTTCCATAAATAAGAGG + Intergenic
979034017 4:115688817-115688839 TTTTAATTTCGTTGAGTAAGTGG - Intergenic
979363048 4:119787132-119787154 TTTGCATATCCTTCATAAAGTGG - Intergenic
979762202 4:124420135-124420157 TTTGTATTGCCTAGAGAAAGAGG - Intergenic
979827152 4:125252257-125252279 TTCCAATTTCCTTGAATAGGAGG - Intergenic
979988155 4:127340763-127340785 TGTAAATTTCCTTCAAACAGTGG - Intergenic
980263739 4:130488639-130488661 TTTGTATTTCCCTGACAATGAGG + Intergenic
981079606 4:140625710-140625732 TTAAAATTTCTTTGAAAATGTGG - Intronic
981575215 4:146197116-146197138 TTTGCATTTCCAGAAAAAAGGGG + Intronic
982200884 4:152959057-152959079 TTTTAAGTTCCTTGCAAAATAGG - Intronic
982754198 4:159199092-159199114 TTTTAATTTATTTGAAAAAATGG + Intronic
983127365 4:163970687-163970709 TTTCTATTTACCTGAAAAAGAGG + Intronic
983197218 4:164820565-164820587 TATGTATTTCTTTTAAAAAGGGG - Intergenic
983296582 4:165874562-165874584 CTTGAAATTCCTGGTAAAAGAGG - Intronic
983850416 4:172573174-172573196 ATTGAATTTCCATGCAAATGTGG + Intronic
983928272 4:173426072-173426094 TTTGAATTTCAGAGAAACAGTGG + Intergenic
985344881 4:188993554-188993576 TTTTAATTTTTTTGAAAAACAGG - Intergenic
986613292 5:9591102-9591124 TTTGCAGTTACCTGAAAAAGTGG + Intergenic
986980714 5:13445541-13445563 CTTGATTTTCCTTGAATCAGAGG - Intergenic
987212063 5:15693427-15693449 TTTAACTTTCTTTTAAAAAGTGG + Intronic
987564969 5:19572919-19572941 TCTGAATTGCCTTGGAAAATTGG + Intronic
987947591 5:24631723-24631745 TTTCCATTTCATTGAGAAAGGGG + Intronic
988132635 5:27124222-27124244 TTTTAATTTCAATAAAAAAGAGG + Intergenic
988156906 5:27465206-27465228 TGTCAATATGCTTGAAAAAGTGG + Intergenic
988197221 5:28019733-28019755 TCTAATTTTCCTTGAGAAAGAGG - Intergenic
988324799 5:29749630-29749652 TTTGAATTTCTTCCAAAAAGAGG - Intergenic
988575659 5:32421545-32421567 TTTTAATTTCATATAAAAAGGGG + Intronic
988945990 5:36200335-36200357 ATATATTTTCCTTGAAAAAGGGG + Intronic
988947788 5:36223850-36223872 TTAAAATTTTCTTGAAAAACAGG + Intronic
989706642 5:44340731-44340753 TTTTAAATTCCTAGAAAAAAAGG - Intronic
990913197 5:60875004-60875026 TTGGAATTACCTGGAGAAAGTGG + Intronic
991428783 5:66521211-66521233 TTTGGAGTTTCTTGAAAAGGAGG + Intergenic
992152706 5:73921425-73921447 GTTGAGTTTCCTTGAATAAGGGG + Intronic
992199674 5:74370822-74370844 TTTGAATTCCTTTGTAAATGGGG + Intergenic
992512677 5:77454500-77454522 TTTCAATTTGATTTAAAAAGGGG - Intronic
992620617 5:78589025-78589047 TCTGAACTTCATGGAAAAAGGGG - Intronic
993038409 5:82783943-82783965 CTTGAATTTCTTTGGAAAATTGG - Intergenic
993160552 5:84285124-84285146 TTTGAATGTTCTTGAATAAGTGG + Intronic
993505831 5:88707688-88707710 TTTGGTTTTACATGAAAAAGTGG - Intergenic
993600009 5:89910730-89910752 TTTGGTTTTCCTTTAAAAGGTGG + Intergenic
994007606 5:94857998-94858020 TTTGAATTACTTAGAAAAACTGG - Intronic
994049524 5:95346733-95346755 TTTTTTTTTCCTTCAAAAAGAGG + Intergenic
994734682 5:103537843-103537865 TATGAATTTCCTTAAAAATATGG - Intergenic
994972928 5:106765442-106765464 TTACAATTTCCATGAAAAATTGG - Intergenic
995669582 5:114586586-114586608 GTTGGAATTCCTAGAAAAAGTGG - Intergenic
996015279 5:118526821-118526843 CTTGAATCTCCTTGAAAGAAGGG - Intergenic
996142691 5:119931674-119931696 TATGAATTTCTTTGAAAATGGGG + Intergenic
996232241 5:121080839-121080861 TTTTAATTTCCTTGAGGATGTGG + Intergenic
996330439 5:122322357-122322379 TTTGAATTTATTTGAATATGTGG - Intronic
998584020 5:143406550-143406572 TTTGTATTACTCTGAAAAAGAGG - Intronic
998764916 5:145475542-145475564 TTTGTATTTCCTTGCAAAAATGG - Intronic
999138166 5:149337655-149337677 TTGGAAGTTCCTTGAAAACCAGG - Intronic
999683144 5:154078438-154078460 TTCTAATTTCCATGATAAAGAGG - Intronic
999954615 5:156686954-156686976 ATTGGATATCCTTGAAAAATGGG - Intronic
1000525164 5:162348587-162348609 TTTGCATTTCCCTGATAAATAGG + Intergenic
1000540679 5:162535772-162535794 TTTAAATTTACTGGAAAAACAGG - Intergenic
1003894665 6:10595999-10596021 TTTGCATTTTCTTTGAAAAGAGG - Intronic
1003994455 6:11524832-11524854 TTTGAATTTTCTTCAAAACCAGG + Intergenic
1005076954 6:21918126-21918148 TTTGAATTTCCTGGATGAAAGGG + Intergenic
1006045718 6:31295378-31295400 TTTGAATTTCACAGAAAAAATGG - Intronic
1006647285 6:35523387-35523409 TTAGAATCTCCTGGGAAAAGAGG + Intergenic
1008213205 6:48751642-48751664 TTAGAATTTCCTGTAGAAAGTGG - Intergenic
1009246339 6:61243278-61243300 TTTGCATTTCACTGAAAAATAGG + Intergenic
1009320946 6:62287111-62287133 TTTAACTTTCCTTTAAATAGAGG - Intergenic
1009430934 6:63565013-63565035 TTTGTTTTTCCTTGAGAGAGAGG + Intronic
1009476931 6:64104222-64104244 TTTGAATTGCTATGATAAAGAGG + Intronic
1009607466 6:65892163-65892185 TTTTAATATGGTTGAAAAAGCGG + Intergenic
1010309041 6:74360934-74360956 CTGGAAGTTCCTTGAAAGAGTGG - Intergenic
1010520842 6:76834635-76834657 TTTTCATTTTCTAGAAAAAGAGG - Intergenic
1010642523 6:78346665-78346687 TTTGAATTTCCTTAAATTACTGG - Intergenic
1010797329 6:80132513-80132535 TTTTATTTTCCTTAAAAAATAGG + Intronic
1011047056 6:83096071-83096093 TTGTTATTTCTTTGAAAAAGTGG - Intronic
1012797001 6:103774774-103774796 CTTGAATTGACTGGAAAAAGTGG + Intergenic
1013214867 6:108018151-108018173 TGTTAACTTCCTTGGAAAAGTGG + Intergenic
1014538260 6:122642980-122643002 TTTTAATTTTTTTAAAAAAGAGG + Intronic
1014744400 6:125183000-125183022 TTGGAAATTCCTCAAAAAAGGGG - Intronic
1014749007 6:125234040-125234062 GTTGACTTTCATTGAAAAACAGG + Intronic
1014825885 6:126048012-126048034 CTTGGATTTACATGAAAAAGTGG + Intergenic
1016626403 6:146174717-146174739 CTTGAATTTTCTTTAAAGAGAGG + Intronic
1017095593 6:150802000-150802022 ATTAAAATTCCTTTAAAAAGGGG - Intronic
1018439221 6:163794066-163794088 CTTCCATTTCCTCGAAAAAGGGG + Intergenic
1018757321 6:166861748-166861770 TTTGATTTTCCTTCAACAAGTGG - Intronic
1020591565 7:10145732-10145754 TTTGGATTGCATTGAGAAAGTGG - Intergenic
1021305534 7:19027064-19027086 TTTTATTATACTTGAAAAAGAGG + Intronic
1021362206 7:19729545-19729567 TTTAAATTTCCTTCAAAACCTGG + Intronic
1022150751 7:27602544-27602566 CTTGTATTTCTTTGAAAAATAGG - Intronic
1022285389 7:28952182-28952204 TTTCAATTAACTAGAAAAAGAGG + Intergenic
1022436437 7:30390359-30390381 TTATAATCCCCTTGAAAAAGTGG - Intronic
1024322186 7:48082367-48082389 TTTTAATTTTTTTAAAAAAGAGG - Intergenic
1024997689 7:55286207-55286229 TTTAAATTTCCTATAAAGAGAGG + Intergenic
1025070020 7:55889734-55889756 TGTGAATTTCATTAGAAAAGAGG + Intronic
1025771740 7:64514449-64514471 TTTTAATTTTCTTCAAAAAATGG + Intergenic
1026484933 7:70809566-70809588 TTTGAATTTCCTGGGTAAACAGG - Intergenic
1027306134 7:76899275-76899297 TTTGGTTTTCCCAGAAAAAGAGG - Intergenic
1027661506 7:80993465-80993487 TTTGAATTGTCTTGAATAAGTGG - Intergenic
1027840219 7:83300472-83300494 TTTCATATTCCTTGAAAAATTGG + Intergenic
1028061221 7:86319228-86319250 TTTGTGTTTCCTTGATAAAAAGG - Intergenic
1028282006 7:88942057-88942079 TTTTAATTTTCTTGGCAAAGTGG - Intronic
1028603002 7:92623063-92623085 TCTGAACTTCCACGAAAAAGAGG + Exonic
1028704100 7:93817543-93817565 TTTGAATTTTCTTCTAAAGGAGG + Intronic
1028781144 7:94737892-94737914 TTTCTATTTCCTTGCAAAGGGGG + Intergenic
1029812125 7:103059891-103059913 TTTCCGTTTCCTTAAAAAAGGGG + Intronic
1030642200 7:112018704-112018726 TTTTGATTTCCATGAAAAAATGG - Intronic
1031045990 7:116888232-116888254 TTTGGTTTTCTTTTAAAAAGAGG - Intronic
1031341506 7:120608396-120608418 TTTCTATTTACTTGAAAATGAGG - Intronic
1032715629 7:134506709-134506731 TTTTTTTTTCCTTGAAACAGAGG - Intergenic
1033307773 7:140237809-140237831 TATGGCTTTTCTTGAAAAAGTGG - Intergenic
1033373844 7:140737938-140737960 TTTTAATATCATTTAAAAAGTGG + Intronic
1033390005 7:140918148-140918170 TGTTAGTTTCCTTGAAAAAAGGG - Intronic
1033628546 7:143134591-143134613 TTTGCATTTCCCTGATCAAGAGG + Intronic
1033916434 7:146331634-146331656 TTTGAGTTTCCTTGGAACACTGG - Intronic
1035256121 7:157628843-157628865 GTTGTATTTCCTTAAACAAGAGG - Intronic
1035927787 8:3747310-3747332 TTAGAATTTGCTTGCAAATGGGG - Intronic
1036282451 8:7413054-7413076 TTTGAAAATTCTTGGAAAAGGGG - Intergenic
1036339020 8:7898495-7898517 TTTGAAAATTCTTGGAAAAGGGG + Intergenic
1036923365 8:12879694-12879716 TTTAATTTTCTTTAAAAAAGAGG - Intergenic
1037069538 8:14626509-14626531 TGTGAACTTACTTGAAAATGGGG + Intronic
1038069207 8:23994811-23994833 TTTAAAGTACCTTGAAAGAGAGG + Intergenic
1038255297 8:25945678-25945700 TTTGAATGTCCCTGAATAATAGG + Intronic
1039181265 8:34869392-34869414 TTTCAATGTACTTGAAAATGTGG - Intergenic
1039967118 8:42291490-42291512 TTTTATTTTAATTGAAAAAGAGG + Intronic
1040397975 8:47017578-47017600 TTTGAATTTCTGTGAAAACAGGG + Intergenic
1040620907 8:49091578-49091600 TTTACATTTCCTTGACAAAAGGG - Intergenic
1040878657 8:52179842-52179864 CTTGTATTTTCTTCAAAAAGAGG + Intronic
1041437848 8:57861949-57861971 TGTAAATTTCCTTTCAAAAGGGG + Intergenic
1042680806 8:71381055-71381077 TTTGATTTTCTTTGATAATGGGG - Intergenic
1043295728 8:78660612-78660634 TTTAAATTTTATTGAAAATGTGG + Intergenic
1043971366 8:86532623-86532645 TTTTTATTTTCTTAAAAAAGAGG - Intronic
1044328991 8:90894045-90894067 TTAGAATTTCTTAGAAACAGAGG + Intronic
1045136079 8:99219848-99219870 TTTGAATTTACATGAAAAAGTGG - Intronic
1045874395 8:106962152-106962174 ATTTAATTTCCTAGGAAAAGTGG - Intergenic
1046258438 8:111732640-111732662 TTTAATTCTCCTTGAAAAATAGG + Intergenic
1046366450 8:113238358-113238380 TTTGTCTTTACATGAAAAAGTGG - Intronic
1046455121 8:114449171-114449193 TGCTAATTTCCTTTAAAAAGTGG + Intergenic
1046667832 8:117024362-117024384 TTTGAATATGCTTTGAAAAGAGG + Intronic
1047067956 8:121307953-121307975 TTAGAATTTTCTAGAAAAATAGG - Intergenic
1050096770 9:2075339-2075361 GTAGAATTTCCTTGAAAAGCAGG - Intronic
1050489153 9:6168851-6168873 TTTTAGTTTTCTTGACAAAGTGG - Intergenic
1051191793 9:14520560-14520582 TATGAAATTCCTTTAAAAGGAGG + Intergenic
1051522637 9:18006968-18006990 TTTGGATTTCATGGAAAAATCGG + Intergenic
1052439561 9:28477524-28477546 TTTCAGTTTCCTAGAAAATGGGG - Intronic
1053129534 9:35607190-35607212 ATTGAAGTGCCTTGAAAAACTGG + Intronic
1053296856 9:36921737-36921759 TTTGTAGTTCCTTGAAAAAGAGG + Intronic
1053897884 9:42763327-42763349 TTTGAATTTTTCAGAAAAAGTGG + Intergenic
1056148224 9:83756534-83756556 TTTGTATTTAACTGAAAAAGTGG + Intronic
1056509529 9:87290158-87290180 ATTGAAACTCCTTGAAAAGGAGG - Intergenic
1058429801 9:104907957-104907979 TTAAAATTTCCTTAAAAAATTGG - Intronic
1058724313 9:107787427-107787449 TCTGAATTTCCTTGCCAACGTGG - Intergenic
1058815909 9:108682695-108682717 TTTCAATTTCCTTGTAAAATGGG + Intergenic
1059051311 9:110929529-110929551 TTTGAGTTGCCTTGAAATAAAGG - Intronic
1059715043 9:116905748-116905770 ACTGAATTTCCTTGGAAGAGTGG + Intronic
1060316164 9:122512854-122512876 TCTGATTTTCCTTGAAAGATTGG + Intergenic
1060316307 9:122514653-122514675 TTTGTATTTCCATCATAAAGAGG + Intergenic
1187596769 X:20781825-20781847 TATGAAGTTTCTTGAACAAGTGG - Intergenic
1188144061 X:26587692-26587714 CAGGAATTTCCTTGAAAAAGTGG + Intergenic
1188961275 X:36494933-36494955 TTTGCATTTCCTTGATGATGAGG + Intergenic
1189117990 X:38363221-38363243 TCTCAAATTCCTTGAAACAGAGG + Intronic
1189577541 X:42370563-42370585 TTTCAAGTTTCTTGAGAAAGAGG + Intergenic
1189681663 X:43522915-43522937 TCTGATTCTACTTGAAAAAGTGG - Intergenic
1190920710 X:54849511-54849533 TTTTAATTTTCTTCAAAAGGTGG - Intergenic
1192004788 X:67198828-67198850 TTTGAACTTCTTGGAAAAAAGGG + Intergenic
1192103935 X:68294906-68294928 TAAGAATTTGCTTGAAAAATGGG - Intronic
1193311767 X:80018435-80018457 TTTGAATTTCTTAAAAAAAAAGG + Intronic
1193415977 X:81224442-81224464 TTTGAATTTCTTTGAAAGAAAGG + Intronic
1193521260 X:82531840-82531862 TTTTAATTTCCATGAAATAAAGG + Intergenic
1193969170 X:88030305-88030327 TCTGAATTTTCCTGAAAAACAGG + Intergenic
1194101397 X:89709960-89709982 TATGAATTTCCTTGAAGAAAAGG - Intergenic
1194373461 X:93103419-93103441 TTTGAAATTCTTTTATAAAGAGG + Intergenic
1194452319 X:94059746-94059768 TTTGAAATTCATTTCAAAAGAGG - Intergenic
1194522672 X:94937519-94937541 ATTCATTTTCCTTTAAAAAGGGG - Intergenic
1196001508 X:110792031-110792053 TTATAATTTCTTTGAAAATGTGG - Intronic
1197012450 X:121582771-121582793 TTTGAATTTCTTTAAGAAAAAGG + Intergenic
1198385129 X:136122090-136122112 TCTGCCTTTTCTTGAAAAAGTGG + Intergenic
1198943504 X:141984227-141984249 TTTGAAATGCCTTTCAAAAGGGG + Intergenic
1198956561 X:142137575-142137597 TTTGAATTGTCTTGTCAAAGAGG - Intergenic
1199127816 X:144144870-144144892 TTTGAATTTGATTGAATAACTGG + Intergenic
1199732489 X:150649971-150649993 TTTTAAATTCCTTAAAAAAATGG + Intronic
1200454349 Y:3371044-3371066 TATGAATTTCCTTGAAGAAAAGG - Intergenic
1200493126 Y:3852264-3852286 TTTGGCATTCCTGGAAAAAGTGG + Intergenic
1200681490 Y:6217463-6217485 TTTGAAATTCTTTTATAAAGAGG + Intergenic