ID: 915790667

View in Genome Browser
Species Human (GRCh38)
Location 1:158666835-158666857
Sequence CTCCTAGAAAATAGAGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915790667_915790668 -10 Left 915790667 1:158666835-158666857 CCAAACACTCTATTTTCTAGGAG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 915790668 1:158666848-158666870 TTTCTAGGAGAAGCATAATGAGG 0: 1
1: 0
2: 1
3: 22
4: 215
915790667_915790669 -6 Left 915790667 1:158666835-158666857 CCAAACACTCTATTTTCTAGGAG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915790667 Original CRISPR CTCCTAGAAAATAGAGTGTT TGG (reversed) Intronic
900309580 1:2027217-2027239 CTCCTAGAAAATCAAGTGCGTGG + Intronic
901271531 1:7955596-7955618 TTCCTTGAAAACAGAGTTTTTGG + Intronic
901298913 1:8184041-8184063 TTCATAGAAAATGCAGTGTTTGG - Intergenic
901322246 1:8346897-8346919 TTCCTAGAAAATGTGGTGTTGGG + Intergenic
902674748 1:18000966-18000988 CTCCTGGAAAAGAGGGTATTTGG + Intergenic
904122964 1:28214622-28214644 CTCCTAGAAGACAGGGGGTTTGG + Intronic
907720168 1:56964586-56964608 CTTCTAGAACAGAGAGTGTGAGG - Intronic
907985144 1:59523173-59523195 CTGCTAGAAAAGTGTGTGTTTGG + Intronic
911227839 1:95326543-95326565 CTTCTTGAAAATAGTTTGTTTGG + Intergenic
911294125 1:96093489-96093511 CTCCATGAAAATAGAATTTTAGG + Intergenic
911697878 1:100913643-100913665 GGCCTAGAAAACAAAGTGTTAGG - Exonic
912397532 1:109358399-109358421 CTGATAGAAAATAAAGTGCTAGG - Intronic
912851848 1:113133044-113133066 CTCCTAAAGAATAAAGTGCTTGG - Intergenic
915790667 1:158666835-158666857 CTCCTAGAAAATAGAGTGTTTGG - Intronic
918128929 1:181608122-181608144 CTCTTAGAAACTAGAGGGCTAGG + Intronic
918948071 1:191095892-191095914 CTCCTAGAAAGTACAATCTTAGG + Intergenic
920577491 1:207072286-207072308 GTCCAAGAAATTACAGTGTTGGG + Exonic
921651410 1:217683142-217683164 CTCCTATCAAATAAAGTCTTGGG - Intronic
923859689 1:237880943-237880965 CTTCTAGATATTAGATTGTTGGG - Intronic
924755422 1:246936521-246936543 CACCTATAAAATAAGGTGTTTGG - Intergenic
1063909234 10:10812538-10812560 CTCCTAAATAATATGGTGTTTGG - Intergenic
1068251182 10:54442963-54442985 ATCCTAGAAAATGTAGTGTCTGG - Intronic
1069138202 10:64791577-64791599 CACATAGAAAATAGTGTGTAGGG + Intergenic
1070121176 10:73578876-73578898 CTCCTAGAATTTATAGTTTTAGG - Intronic
1072624648 10:97103377-97103399 CTGCTGGGAAAAAGAGTGTTGGG - Intronic
1073876955 10:107935803-107935825 CTCCTAGAAAACAAAGTCTAAGG - Intergenic
1075355368 10:121767852-121767874 CTCCTAGAAATGAGATTGGTGGG - Intronic
1077429056 11:2506615-2506637 TTCCTAGAAATGGGAGTGTTGGG + Intronic
1079019849 11:16900774-16900796 GTCCTAGAAAAAAGATTTTTTGG - Intronic
1079985956 11:27201132-27201154 CTCCTGGAAAATGAATTGTTTGG - Intergenic
1080128816 11:28769166-28769188 CTTGTAGAAAACAGATTGTTGGG - Intergenic
1081214469 11:40378473-40378495 CTCTTACAAAAGATAGTGTTTGG + Intronic
1084060615 11:66671108-66671130 CTGCTAGAAACTGGAGTGATAGG - Intronic
1086779230 11:90881539-90881561 CTCCTATTGAATATAGTGTTAGG + Intergenic
1088970493 11:114770705-114770727 CGCCTATAAAATAGACTGGTTGG - Intergenic
1089444461 11:118540729-118540751 CTTCTGAAAAAAAGAGTGTTTGG - Intronic
1089833520 11:121349786-121349808 ATTCTAGAGAATACAGTGTTGGG + Intergenic
1089931656 11:122319139-122319161 CTGGTAGAAAATAGAGGGCTTGG - Intergenic
1096965529 12:55624280-55624302 TTCCTAAAGAATAGAGTCTTTGG + Intergenic
1099771502 12:87064468-87064490 CTCCTAGGAAATAGCATTTTGGG - Intergenic
1099987771 12:89687667-89687689 CTCTTAGTAAATAGAGTGTATGG - Intronic
1100964928 12:100002215-100002237 TTCCTAGAAAATGGATTGTTAGG + Intergenic
1102812168 12:115833581-115833603 CTCCTCTAAAATAGAGAGTTGGG - Intergenic
1103197537 12:119057976-119057998 CTCCTGGAAAATAGACTCTCTGG + Intronic
1104638617 12:130453168-130453190 CTCCTAGGAAGGAGTGTGTTGGG - Intronic
1105758687 13:23493449-23493471 CTCGTAGAAAATGGGGTGGTGGG + Intergenic
1108201138 13:48044616-48044638 CCCCTAGAAAATGAAGTGTCTGG - Intronic
1108708262 13:53009529-53009551 TTCCTAAAAAATATAATGTTGGG + Intergenic
1109975082 13:69820915-69820937 TTCCAAGAAAACAGAGTTTTAGG - Intronic
1111046744 13:82823736-82823758 CTCCCAGAATTTAAAGTGTTTGG + Intergenic
1113189250 13:107724879-107724901 TTCCTAGAAAATACAGGTTTGGG - Intronic
1113243973 13:108374142-108374164 CTCTTAGGAAACAGATTGTTGGG + Intergenic
1114731335 14:24995666-24995688 CTCCTAGAAAATAAACTTCTTGG + Intronic
1114762320 14:25330025-25330047 CTCCTATAATATACACTGTTGGG + Intergenic
1114911540 14:27205203-27205225 CTCCTACAAGAAAGAGTGCTAGG + Intergenic
1116154948 14:41191686-41191708 CTTGTAGAAAACAGATTGTTAGG - Intergenic
1117242465 14:53848572-53848594 CTCCTTCAAAATGGAGTTTTTGG - Intergenic
1117541521 14:56751193-56751215 CTTCTATAAAATAGAGGGTGTGG - Intergenic
1117808741 14:59522559-59522581 CTGAAAGAAAATAGAGAGTTTGG - Intronic
1118632472 14:67718344-67718366 CTCTTACAAAATAGAGTGAGAGG - Intronic
1120358473 14:83463938-83463960 CTCATAGATAATATAGAGTTGGG + Intergenic
1202831926 14_GL000009v2_random:43726-43748 GTTCAAGAAAAAAGAGTGTTAGG - Intergenic
1133474262 16:6104931-6104953 CTCCTAGAAAAGAAAGTTCTAGG - Intronic
1134512651 16:14860716-14860738 CTCCTTTAAAGTAGAGTATTTGG + Intronic
1134700287 16:16259211-16259233 CTCCTTTAAAGTAGAGTATTTGG + Intronic
1134971537 16:18535448-18535470 CTCCTTTAAAGTAGAGTATTTGG - Intronic
1139027487 16:62836380-62836402 CTGCTAGCAAATATATTGTTTGG - Intergenic
1140842170 16:78849765-78849787 CCCATAAAAAATAGAGTGATAGG + Intronic
1143981968 17:10877896-10877918 CTCCTTGAGAATAGAGTCCTTGG - Intergenic
1146717015 17:35094937-35094959 CTACTAGAAAGGAGAGTGTGTGG - Intronic
1149281583 17:55111142-55111164 CTACTAGAGAATAGACTGTAGGG - Intronic
1149983218 17:61327981-61328003 TTCCTAGAAAATAAATTGCTGGG - Intronic
1152094945 17:78267418-78267440 CTCCTAGAAGAGAGAGTCTGTGG + Intergenic
1153030303 18:707700-707722 CTCTTAGAATATAGTGTGTCTGG - Intronic
1155372792 18:25121077-25121099 CCCCTAAAAAATAGAGTGAAAGG + Intronic
1156900114 18:42290667-42290689 GTCCTAGGAAATAGTGTGTGTGG + Intergenic
1157061604 18:44297808-44297830 TTCCTAGAACATTGATTGTTTGG - Intergenic
1158013449 18:52755894-52755916 CTCCTAGAAAATAGGATGAATGG - Intronic
1158370658 18:56799179-56799201 CAGCTGGAAAATAGAGTATTTGG + Intronic
1159908220 18:74117934-74117956 CTCCTCAAGAATAGAGTGATGGG + Intronic
1161882983 19:6970645-6970667 GTCCTAGCCAATAGAGTGTGAGG + Intergenic
1168463330 19:56580709-56580731 CTGCTAGAAAATGGAGTTTGGGG + Exonic
1202640756 1_KI270706v1_random:84026-84048 GTTCAAGAAAAAAGAGTGTTAGG + Intergenic
929422637 2:41809274-41809296 CACCTAGAAACAAGAGTGCTGGG + Intergenic
929942038 2:46341579-46341601 CTCCTAGATAAATGACTGTTTGG + Intronic
931015155 2:57969060-57969082 GTATTATAAAATAGAGTGTTTGG + Intronic
934499823 2:94848990-94849012 CTCTTATAATATACAGTGTTTGG - Intergenic
934913453 2:98279218-98279240 TTCTTAGAAAATAGAGTTTGGGG - Intronic
935509035 2:103948340-103948362 CTCCCAGAAAATCAGGTGTTGGG + Intergenic
938835659 2:135101501-135101523 ATTCTAGAAAATAGATTTTTGGG + Intronic
939351364 2:141042137-141042159 ATCCTTGAAAATAGAGTCTAAGG - Intronic
939633177 2:144550198-144550220 CTCCTAGTAAGTGGAGGGTTTGG - Intergenic
940069557 2:149670614-149670636 CCCCAAGAAATTATAGTGTTCGG + Intergenic
940921533 2:159313113-159313135 TTCCTAGAAAATAGAGTTTTGGG - Intergenic
941278117 2:163516675-163516697 CCCCTAGAAAATAGAGCCTAAGG + Intergenic
941295329 2:163732006-163732028 CTTCTTTAAAATAGAGTTTTTGG - Intronic
943488993 2:188526022-188526044 CTAATGGAATATAGAGTGTTAGG - Intronic
945620227 2:212127019-212127041 CTTCTAGAAAATATACTTTTTGG - Intronic
946161622 2:217839279-217839301 CTCCTTGAACATAGGGTGTTAGG - Intronic
946641337 2:221786590-221786612 ATCATAGAAAATAGAGAGCTTGG + Intergenic
948228346 2:236330800-236330822 CTCCTATAAGAGAGGGTGTTGGG + Intronic
1171891049 20:30715740-30715762 CTCTTATAATATAGAGTGTTTGG - Intergenic
1177030578 21:15978704-15978726 CTCCTAGAATTGAGAGTATTTGG + Intergenic
1180361194 22:11897836-11897858 GTTCAAGAAAAAAGAGTGTTAGG - Intergenic
1180420031 22:12805432-12805454 CTCCTATTCAATATAGTGTTGGG + Intergenic
1183490077 22:38111372-38111394 ATCCTGGAAAACAGAGTGTCCGG + Intergenic
1184014455 22:41775443-41775465 ATCCTGGAAAATAGAGCTTTGGG + Intronic
950143127 3:10628837-10628859 CTCCTAGGAAATACAGGGTCAGG + Intronic
950750814 3:15126733-15126755 TTCCTAGTCAATAAAGTGTTCGG + Intergenic
951247651 3:20359690-20359712 TTCCTAGAAAATAGAATCTGAGG + Intergenic
951873753 3:27397008-27397030 CTCCTAGAAAATTGAATTTTAGG + Intronic
952023452 3:29051109-29051131 CTATTACAAAATAGAGTCTTAGG + Intergenic
952030989 3:29142588-29142610 ATTCTAGAAAATAAACTGTTAGG + Intergenic
952698854 3:36303753-36303775 CTCCTTGAAATTATAGTCTTGGG + Intergenic
952829217 3:37549850-37549872 CTAGTAGATAATAGTGTGTTTGG + Intronic
955522701 3:59790749-59790771 CTCATAGATATTACAGTGTTGGG - Intronic
955540029 3:59965259-59965281 TTCATAGAAAATATAGTGTATGG + Intronic
955767189 3:62357084-62357106 CTGCTAGAAAAAAGAGATTTGGG - Intergenic
958840189 3:99194061-99194083 CTTCTAGAAAACAGATTATTGGG - Intergenic
963353218 3:144177738-144177760 CACCCACAAAGTAGAGTGTTAGG - Intergenic
963527861 3:146436800-146436822 CTCCTATTCAATATAGTGTTGGG - Intronic
963645372 3:147907079-147907101 CTCTGAGAAAATTGAGTGGTGGG - Intergenic
963844648 3:150142992-150143014 CTTCCAGAAAATAGACTTTTAGG + Intergenic
963867921 3:150382997-150383019 CTCCTAGGAAAGGGAGTGTTGGG - Intergenic
1202737796 3_GL000221v1_random:23361-23383 GTTCAAGAAAAAAGAGTGTTAGG - Intergenic
969271140 4:6103536-6103558 CTTCCAGAAAATAGAGAATTAGG - Intronic
969967723 4:11014268-11014290 CTCCTAGAAAGGAGAGTGTAGGG + Intergenic
971001605 4:22329446-22329468 CTACTAGATAAGGGAGTGTTGGG - Intergenic
971127019 4:23765211-23765233 CTCCTAGAAAAGACAGGGATGGG + Intronic
973361742 4:49171835-49171857 CTCCTATTCAATATAGTGTTGGG - Intergenic
973384274 4:49494558-49494580 GTTCAAGAAAAAAGAGTGTTAGG + Intergenic
974480205 4:62432940-62432962 CTTGTAAAAAATAGAGTTTTAGG - Intergenic
974573972 4:63692201-63692223 CTCGTAGAAAACAAAGAGTTGGG - Intergenic
974907975 4:68080579-68080601 TTCCCAGAAATTAGAGGGTTGGG - Intronic
975215670 4:71751394-71751416 CTCCTATAAACCACAGTGTTAGG - Intronic
976528399 4:86120047-86120069 CTTCTGGAGAATACAGTGTTTGG + Intronic
977335206 4:95689459-95689481 CCCCTCCCAAATAGAGTGTTGGG - Intergenic
978357753 4:107894916-107894938 CTCATAGAAAATACAGTCTTAGG + Intronic
979450355 4:120863414-120863436 CTTCTAAAAAATCAAGTGTTGGG + Intronic
981872164 4:149499181-149499203 CTCCTAGAAAGCAGAATGTGGGG + Intergenic
982878446 4:160677255-160677277 CTCCCAGAAAATCTAGTTTTGGG - Intergenic
982975569 4:162054625-162054647 CTCTAAGAAAAGAGAGTGATGGG - Intronic
983675803 4:170290627-170290649 CCCCTAGAAAAGAGAGTCTGAGG - Intergenic
984783716 4:183549457-183549479 CTGCTAGAAAATACAGTGACTGG - Intergenic
1202768125 4_GL000008v2_random:169881-169903 GTTCAAGAAAAAAGAGTGTTAGG + Intergenic
988182260 5:27811953-27811975 GTCTTAGAATATAGATTGTTAGG - Intergenic
988667533 5:33345932-33345954 CTTCTAGAATCTAGAATGTTAGG + Intergenic
990193092 5:53283211-53283233 CTTTTAGAAAATAGAGTGAAAGG - Intergenic
991562282 5:67966240-67966262 TTCCTAGAAATGAGATTGTTGGG + Intergenic
992089615 5:73305263-73305285 CTCCTGTAAAATAAAGTGGTTGG + Intergenic
994927517 5:106136695-106136717 CACCTAGAAAAGAGAGGCTTTGG - Intergenic
996920589 5:128763370-128763392 TTGCTAGAAAATATTGTGTTGGG - Intronic
1000299462 5:159942734-159942756 CTCATAGAAAATAGAATATTTGG - Intronic
1000734861 5:164886358-164886380 CTCCAGGAAAATAGTGTTTTTGG - Intergenic
1001031666 5:168267718-168267740 CTCTTAGAAAAATCAGTGTTTGG - Intergenic
1003810663 6:9776385-9776407 AGCCCAGAAAATAGAGTTTTAGG + Intronic
1004051993 6:12092268-12092290 CAACTAGAAAATATATTGTTTGG - Intronic
1006231282 6:32589218-32589240 CTCCTAGACGATCCAGTGTTAGG - Intronic
1008009588 6:46451557-46451579 CTCCTACAAACTAGAGTGAGGGG + Intronic
1009648108 6:66435235-66435257 CTCCTAGAAAACACAGAATTTGG - Intergenic
1011994580 6:93569054-93569076 CTCATAAAAAATAGAGTGGAGGG + Intergenic
1012083666 6:94794147-94794169 TTCTAAGAAAATATAGTGTTAGG - Intergenic
1014829398 6:126084103-126084125 TGCCTAGAAAATAGATTGCTGGG + Intergenic
1018196371 6:161359119-161359141 CTCCTAGAAAATGAAGGGATTGG - Intronic
1018988777 6:168657801-168657823 CTCCTAGGAAAGAATGTGTTTGG - Intronic
1021929234 7:25562847-25562869 GTCCTAGAAATTGGATTGTTAGG - Intergenic
1025761298 7:64397319-64397341 ATTCTAAAAAAAAGAGTGTTTGG + Intergenic
1030149954 7:106394385-106394407 CTCATAGAAAGTAGACTGTGTGG - Intergenic
1030513115 7:110509303-110509325 CTCCTAGAAATAGGATTGTTGGG + Intergenic
1031589619 7:123573577-123573599 CTCTTATAAACTGGAGTGTTTGG - Intronic
1033270919 7:139932254-139932276 CTAATAGAAAAAAGAGTGTCTGG + Intronic
1033978171 7:147127717-147127739 CTCATTGAAAATAAAGTGGTTGG + Intronic
1035046774 7:155973060-155973082 AGCTTAGAAAATTGAGTGTTTGG - Intergenic
1035909235 8:3547547-3547569 CTCATACAAAATTGAGTTTTAGG + Intronic
1037406175 8:18545239-18545261 CACCTAGAAAATAAAATGTGTGG - Intronic
1038608916 8:29041262-29041284 CTCCAAGAAGCAAGAGTGTTGGG - Intronic
1039188997 8:34950997-34951019 CTCCTAGAAAAGAGAGCCCTGGG + Intergenic
1043094424 8:75948443-75948465 CTCATAGTCAATAGAATGTTTGG + Intergenic
1043737188 8:83763528-83763550 CTCCTAAACAATAAAGTGATGGG + Intergenic
1048198381 8:132351426-132351448 TTCGTAGAAATTAGAGAGTTGGG - Intronic
1049019948 8:139949376-139949398 CTCCTAGAAATGAAATTGTTGGG - Intronic
1050314286 9:4385361-4385383 CTTCTAGAAAATACAGTTCTTGG + Intergenic
1050756542 9:9011242-9011264 CCCCCAAAAAAGAGAGTGTTGGG - Intronic
1051091492 9:13414635-13414657 CTACCAGAAAATAGGGTTTTGGG - Intergenic
1052193240 9:25682397-25682419 CTCCTAGACAAAAGAATGTGAGG - Intergenic
1052778145 9:32753901-32753923 TACCTACAAAATAGAGTGATTGG + Intergenic
1054357799 9:64080049-64080071 CTCTTATAATATAGAGTGTTTGG + Intergenic
1054677091 9:67867572-67867594 CTCTTATAATATACAGTGTTTGG + Intronic
1054884165 9:70177897-70177919 CTCCTAGAAAATACAATGATTGG + Intronic
1056905004 9:90638883-90638905 CTCCAATAAAACAGAGTGTAAGG + Intronic
1057760865 9:97873464-97873486 CTGTTAGAAAATAGATGGTTTGG - Intergenic
1058243047 9:102590810-102590832 CTTCCAGAAAACAGAGTTTTTGG - Intergenic
1058907263 9:109492049-109492071 CTTGTAGAAAATAAAGTGTCAGG - Intronic
1203554832 Un_KI270743v1:197644-197666 CTCCTATTCAATATAGTGTTGGG + Intergenic
1203560660 Un_KI270744v1:53472-53494 CTCTTATAATATAGAGTGTTTGG - Intergenic
1191752310 X:64556201-64556223 CTCCTAGAAAACTTAGGGTTGGG - Intergenic
1191940637 X:66477015-66477037 CTCCTAGAAAATGAAGGGATTGG + Intergenic
1193847316 X:86489938-86489960 TTACTAGAAAATAGCGTCTTTGG + Intronic
1195486957 X:105420187-105420209 CTTTTTGAAAATATAGTGTTAGG + Intronic
1197187584 X:123605586-123605608 TTCCTATAAAATGGTGTGTTTGG + Intronic
1198494321 X:137175853-137175875 CTCCTTGAAGATAGAGTGCGAGG - Intergenic
1199169119 X:144715700-144715722 ATTCTAGAAAATGAAGTGTTAGG + Intergenic