ID: 915790669

View in Genome Browser
Species Human (GRCh38)
Location 1:158666852-158666874
Sequence TAGGAGAAGCATAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915790667_915790669 -6 Left 915790667 1:158666835-158666857 CCAAACACTCTATTTTCTAGGAG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191
915790665_915790669 18 Left 915790665 1:158666811-158666833 CCTCTTTTTCAAGGAAATTCAAA 0: 1
1: 0
2: 3
3: 48
4: 441
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191
915790664_915790669 23 Left 915790664 1:158666806-158666828 CCAGACCTCTTTTTCAAGGAAAT 0: 1
1: 0
2: 1
3: 31
4: 526
Right 915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915790669 Original CRISPR TAGGAGAAGCATAATGAGGT TGG Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG + Intergenic
905503832 1:38460609-38460631 GAGGAGAGACATACTGAGGTTGG - Intergenic
908838473 1:68253350-68253372 AAAGAGAAGAATCATGAGGTGGG + Intergenic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
913355869 1:117921579-117921601 TAGGAAAAGCAGAATAAGCTAGG + Intronic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
914221846 1:145688624-145688646 TAGTAGAAGCTTGGTGAGGTAGG + Intronic
914463027 1:147902387-147902409 TGGGAGAATCTTAATGATGTAGG - Intergenic
914679647 1:149930061-149930083 TAGTTGAAGCCTAATGAGGAGGG - Intronic
914684047 1:149962364-149962386 TAGGAGGAGGATAATGAACTGGG - Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916485321 1:165253696-165253718 GAGGAGAAGCATATCGAGATAGG - Intronic
916486034 1:165259479-165259501 TATGAGAACCAAAATGATGTGGG - Intronic
919983420 1:202656806-202656828 TGGGAAGAGCATAATGTGGTGGG - Intronic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
924866518 1:247987790-247987812 TGGGAGAAGGGTAATGAGTTTGG - Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1078013297 11:7590912-7590934 TAGGAGAAGCATAATTATTCCGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1080307970 11:30857227-30857249 TAAGAGAAGTATAGTGAAGTGGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG + Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087551470 11:99655799-99655821 TAGTAGTAGAATAAAGAGGTAGG + Intronic
1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG + Intergenic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1093393582 12:18652770-18652792 TACTAGAAACCTAATGAGGTGGG + Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095653971 12:44647935-44647957 TAGGTGATGCATCATGTGGTTGG + Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1099311851 12:81035806-81035828 TAAGAAAAGCTTTATGAGGTAGG + Intronic
1102940981 12:116941504-116941526 TAGCAGAAGCATAATTAAGGAGG + Intronic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1109483538 13:62988557-62988579 TAAGAGAAGCTTAAAGAAGTGGG - Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1127562754 15:60156631-60156653 TAAGAAAAGCATAATGGTGTAGG + Intergenic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1149975475 17:61261504-61261526 TAACAGAAGAGTAATGAGGTTGG - Intronic
1150456528 17:65310900-65310922 TAGGAGAAGCAAAATCCTGTTGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151357697 17:73570240-73570262 TAGGAGATGCATGTTGAGGCCGG - Intronic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156565180 18:38180191-38180213 TAGAAAAAGCATAATTAGGCCGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1163855159 19:19695926-19695948 AATTAAAAGCATAATGAGGTCGG - Intergenic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926974672 2:18502566-18502588 TAATAGAAGCAAAATGTGGTGGG + Intergenic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931083598 2:58803996-58804018 TGGGTCAAGCATAATGAAGTGGG + Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
936722325 2:115267694-115267716 TAGGAGAAGAATAAGCATGTGGG - Intronic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
941094023 2:161214916-161214938 AAGGAGAGGCATATTGAGCTTGG + Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
943300229 2:186189041-186189063 TAGGCCAAGCATAATGACATTGG - Intergenic
943993325 2:194726517-194726539 TAGGACAACCCTAATGAAGTAGG - Intergenic
944275753 2:197835564-197835586 TAGGAGCAGCATGATATGGTAGG + Intronic
944355145 2:198778728-198778750 TAGGAAAAGCATCAAGAGTTAGG - Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG + Intronic
1175538393 20:59731788-59731810 TAGAAGAAGCTTAATGACTTGGG + Intronic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
951548899 3:23857147-23857169 TAGGAGAAGCATCAGGAAATTGG + Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
968039859 3:195579753-195579775 TGGGAGATGCATAATTAGGTGGG - Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973989541 4:56390163-56390185 TAGGAGAGGAATACTGAGTTTGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG + Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
998940468 5:147276679-147276701 TAGCATAAGCTTAATGAGGGTGG - Intronic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006269620 6:32953749-32953771 TAGGAGGAACATAATCAGGCAGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014281409 6:119446013-119446035 TAGGAGAGGGCTGATGAGGTGGG - Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1023555828 7:41421914-41421936 GATTAGAAGCATCATGAGGTAGG - Intergenic
1024282587 7:47731716-47731738 CAGCAGAAGCATGATGAGCTAGG - Intronic
1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1030499148 7:110337542-110337564 CAGGTAAAGCTTAATGAGGTAGG - Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1033430291 7:141283004-141283026 TAGAGGAAGCATTATTAGGTTGG - Intronic
1033965873 7:146974641-146974663 TAGTAAAAGCATATTGATGTTGG + Intronic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG + Intronic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1038949329 8:32397082-32397104 TAGGAGATGGATAAATAGGTAGG + Intronic
1039100507 8:33936797-33936819 TAGGTGAAGCAGAATTTGGTGGG + Intergenic
1040855152 8:51941462-51941484 TTGGGGAAACATAATGAGTTTGG - Intergenic
1044747893 8:95388993-95389015 GAGGAGAAGCATCATGTGCTTGG + Intergenic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG + Intronic
1052748450 9:32464362-32464384 TAGTAAAAGTATAACGAGGTAGG - Intronic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG + Intronic
1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG + Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1060109797 9:120898622-120898644 TAGAAGCAGCATAATGTTGTGGG - Intergenic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1191675276 X:63786082-63786104 TGGGGGAATCATAAAGAGGTGGG - Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1193213423 X:78835318-78835340 TAGGAGAAGAATCTTGGGGTTGG - Intergenic
1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG + Intronic
1194497977 X:94640938-94640960 TAAAAGAAGTATAATGATGTTGG - Intergenic
1194866188 X:99070911-99070933 TAGTAGACGCATAATCAAGTAGG - Intergenic
1195457844 X:105089524-105089546 TAGGGGATGGAAAATGAGGTGGG - Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1198465644 X:136902474-136902496 TGGGAGAAGCATATTTAGATTGG + Intergenic