ID: 915790902

View in Genome Browser
Species Human (GRCh38)
Location 1:158669882-158669904
Sequence ATGTGGGAGGAGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915790898_915790902 15 Left 915790898 1:158669844-158669866 CCATAGTTTGGGTAGCTGTTTAA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 36
4: 371
915790895_915790902 30 Left 915790895 1:158669829-158669851 CCACTGAGTAAGTGGCCATAGTT 0: 1
1: 0
2: 1
3: 16
4: 107
Right 915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 36
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915790902 Original CRISPR ATGTGGGAGGAGAAGTTTGA AGG Intronic
901220548 1:7581133-7581155 TTGCGAGAGGACAAGTTTGAGGG + Intronic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
902006910 1:13239377-13239399 ATCTGGGAGGTGGAGTTTGCAGG + Intergenic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904491351 1:30861447-30861469 ATGTTGGAGTAGGGGTTTGAAGG + Intergenic
905892569 1:41526508-41526530 ATGTGTGAGGGCAAGTGTGACGG - Intronic
905905806 1:41617783-41617805 ATGTGGGAGTAGAATTTGGCTGG - Intronic
907234378 1:53031830-53031852 AGGTGGGAGGAGAAGTAGTAAGG + Intronic
909136726 1:71810619-71810641 GTGTTGGAGGAGAAGCTTGGTGG + Intronic
909522679 1:76587795-76587817 ATGTGGGTGGAAAAGCCTGAAGG + Intronic
910284849 1:85542417-85542439 AAGTTGGAGAAGAGGTTTGAGGG - Intronic
910430096 1:87151792-87151814 GTGTGGGAAGAGAAACTTGAGGG + Intronic
910434527 1:87191653-87191675 ATGTGAGAGGAGAGGTTTGGGGG + Intergenic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
911200311 1:95037369-95037391 ATGAGGCAGGAGATGTTTGCTGG + Intronic
911979312 1:104546060-104546082 ATGTTGGAGGAGAGGTCTGGTGG + Intergenic
913276072 1:117139070-117139092 AGGTGGGGAGAGAAGTTTAATGG + Intergenic
913366403 1:118044653-118044675 ATGTTGGAGGAGGAGTCTGGTGG + Intronic
913659815 1:120996647-120996669 ATGTGGTAGAAGAAGATTTATGG - Intergenic
914011172 1:143779771-143779793 ATGTGGTAGAAGAAGATTTATGG - Intergenic
914166662 1:145181359-145181381 ATGTGGTAGAAGAAGATTTATGG + Intergenic
914266458 1:146042218-146042240 ATCTGGGAGGCGAAGGTTGTAGG - Intergenic
914649795 1:149688426-149688448 ATGTGGTAGAAGAAGATTTATGG - Intergenic
915296168 1:154923398-154923420 ATGTGGGAGGCAAAGTTTTTGGG - Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
915955167 1:160214842-160214864 ATGTGGGAGTAAAACTTTAATGG + Exonic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
919802997 1:201364741-201364763 CTGTGGGAAGGCAAGTTTGATGG + Intronic
921694511 1:218192112-218192134 AGGTGGGGGGATGAGTTTGAGGG + Intergenic
921782433 1:219181603-219181625 TTGTGGGAGCAAAAGTGTGAGGG + Intronic
923359633 1:233198274-233198296 ATGGGGGAGGTGAAGTGTGATGG - Intronic
924419755 1:243897091-243897113 GTAAGGGAGGAGAAGTTTTAAGG + Intergenic
1063094743 10:2899463-2899485 GTGTTGGAGGAGAAGTCTGGTGG - Intergenic
1065754957 10:28922667-28922689 AGCTGGGAGAAGAAGTGTGAGGG + Intergenic
1067672911 10:48342039-48342061 ATGTGGCAGGAGAAGTATGCAGG + Intronic
1068275452 10:54790094-54790116 ATGGGGAAGGAGAAGTCTTATGG - Intronic
1069581571 10:69570295-69570317 ATCTGGGAGGAGGAGATTAATGG - Intergenic
1069896534 10:71683628-71683650 ATGTGGGAGCAGAATTTAGGGGG + Intronic
1070357971 10:75658987-75659009 AGGTGGCTGGAGAAGCTTGATGG + Intronic
1070558887 10:77550870-77550892 ATCTGGGAGGTGAAGCTTGAGGG - Intronic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1071986733 10:91059194-91059216 ATATGGGAGAAGAACTTAGAAGG + Intergenic
1073253918 10:102139014-102139036 AGGTGGGAGGAGGAGTGTGTGGG + Intronic
1074256553 10:111808256-111808278 ACGTGGGAGTAAACGTTTGATGG - Intergenic
1077212089 11:1375766-1375788 GTGTGGGAGAAGAGGCTTGAGGG - Intergenic
1077749092 11:4943786-4943808 ATGGGGGAGGTGAAGATTTATGG - Intronic
1078578339 11:12519564-12519586 TTGGGGGAGGAACAGTTTGATGG + Intronic
1078855417 11:15202665-15202687 AAATGGGAGGAGAAGATAGAAGG + Intronic
1078964492 11:16322218-16322240 ATGTTGGAGGAGAGGCTTGGTGG + Intronic
1079193824 11:18306204-18306226 ATGTGGGAAGTGAACTTTGATGG - Exonic
1081036337 11:38150883-38150905 ATGTGGGAGGAGAAGCCTCGTGG + Intergenic
1081476564 11:43438770-43438792 ATCTTGGAAGAGAAGTTTCAAGG - Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1082665137 11:55966724-55966746 AAGAGGCAGAAGAAGTTTGAGGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1084191100 11:67499115-67499137 TGGTGGGAGGAGAAGTTTGGAGG - Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1086101313 11:83102750-83102772 GTGTGGGAAGAGAAGTGGGAAGG - Intergenic
1086419520 11:86624751-86624773 ATGCCAGAGGAGAAGTTTGGAGG - Intronic
1086943885 11:92825932-92825954 ATGTGAGAGAGGAAGTTAGAAGG + Intronic
1087455087 11:98374895-98374917 ACCTGGGAGGAGAAGGTTGCAGG - Intergenic
1088087672 11:106001097-106001119 TTGTGGTAGGAGAACTTGGAGGG + Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088885562 11:114003625-114003647 ATGTGAGATGAGAAGCTTGCTGG + Intergenic
1089067280 11:115671371-115671393 AGGAGGGAGGAGAAGGGTGAAGG - Intergenic
1089896508 11:121935555-121935577 AGGTGGGAGGAGAAGCTACATGG + Intergenic
1089932444 11:122327507-122327529 TGGTGGGAGGAAAAGTTTAAAGG + Intergenic
1090189925 11:124760884-124760906 AGGCGGGATGAGAAGTCTGAGGG + Intronic
1093195912 12:16129459-16129481 ATGCAGGAGGAGAAGTTTCTTGG - Intergenic
1093844452 12:23951341-23951363 AATTGGGAGGGGAAGTTGGAAGG - Intergenic
1093973511 12:25396428-25396450 ATGAGGAAGCATAAGTTTGAAGG + Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1097312942 12:58141040-58141062 ATGTTGGAGGAGAGGTCTGGTGG + Intergenic
1097880430 12:64681518-64681540 ATGTGGGATGGGAAGTTGGCAGG - Intronic
1099706351 12:86157845-86157867 ATGTCGGAGGAGGAGCCTGATGG - Intronic
1100781865 12:98035464-98035486 ATATGGGAGGAGAACTGTAAAGG + Intergenic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1101649043 12:106658333-106658355 AGTTGGGTGGAGAACTTTGAAGG - Intronic
1103397658 12:120620426-120620448 ATGATGGAGGAGAGGATTGAAGG + Intergenic
1103859728 12:124002719-124002741 ATGAGGAAGGAACAGTTTGAGGG + Intronic
1104467969 12:129005494-129005516 CTGAGGGAGGAGCAGTTTGGAGG + Intergenic
1104468005 12:129005667-129005689 CTGAGGGAGGAGCAGTTTGGAGG + Intergenic
1104468034 12:129005812-129005834 CTGAGGGAGGAGCAGTTTGGAGG + Intergenic
1105918714 13:24941122-24941144 AAGTAGGAGGAGAGGTTGGAAGG + Intergenic
1106046501 13:26146838-26146860 GTGTTGGAGGAGAGGCTTGATGG + Intronic
1106522027 13:30506498-30506520 AGATGGAAGGAGAAGTGTGAGGG - Intronic
1107152712 13:37130332-37130354 ATAAGGAAGGAGAAGTATGATGG - Intergenic
1108062914 13:46551626-46551648 ATGTGAGAGGGGAGGTTTGCGGG + Intergenic
1108438765 13:50427485-50427507 AAGTGTGAGGAGAAGCTTCAGGG + Intronic
1108911080 13:55551821-55551843 GTGTGGGAGGAGCAGTCTGTTGG + Intergenic
1109123037 13:58482688-58482710 ATGTTGGAGGAGAGGTCTAATGG - Intergenic
1109992862 13:70081945-70081967 ATGTGGGAGGAGGAGGCTGGTGG + Intronic
1111417562 13:87968790-87968812 GTGTGGGTGAAGAAGATTGAAGG + Intergenic
1111729189 13:92051851-92051873 ATGTGGAAAGAGAACATTGATGG + Intronic
1111824796 13:93254077-93254099 ATTTGGGAGGCCAAGGTTGAAGG + Intronic
1112797396 13:103071305-103071327 AGATGGGAGGAGAAGTTGGGGGG + Intergenic
1112835511 13:103509324-103509346 AAGTGAGAGGAGGAGTTTGCAGG + Intergenic
1112835515 13:103509364-103509386 AAGTGAGAGGAGAAGTTTGCCGG + Intergenic
1113608729 13:111628377-111628399 ATGTTTCAGGAGAAATTTGATGG - Intronic
1114341161 14:21745996-21746018 ATCTGGGAGGTGAAGGTTGCAGG + Intergenic
1114365258 14:22019737-22019759 GTGTTGGAGGAGAAGTCTGGTGG + Intergenic
1114672510 14:24418938-24418960 ATGTGGGTGTAGCATTTTGAAGG - Exonic
1116979804 14:51156512-51156534 ATGTTGGAGGTGGAGTATGATGG + Intergenic
1118201734 14:63680313-63680335 GTGTTGGAGGAGGAGTCTGATGG - Intergenic
1118880335 14:69820128-69820150 AGGTGGGAAGAGAAGGGTGATGG + Intergenic
1119037860 14:71245848-71245870 ATGAGGGTGGTGAGGTTTGAGGG - Intergenic
1119729491 14:76941976-76941998 CTGTGGGCGGAGGAGTTTCAGGG + Intergenic
1119761503 14:77155154-77155176 ATGTGGGAGGAGACATTTGGGGG + Intronic
1121619345 14:95335400-95335422 ATGCTGGAGGAGAGCTTTGAAGG + Intergenic
1122983276 14:105201096-105201118 TTGTGGGAGGGGAAGTCCGAAGG + Intergenic
1123129899 14:105976639-105976661 ATATGGTGGGAGAAATTTGAAGG + Intergenic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125382551 15:39102798-39102820 CTGTGGGAGGAGGGGTCTGATGG + Intergenic
1127760614 15:62135919-62135941 GTGTGGGAGGAGACGCTGGAGGG + Intergenic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1128845517 15:70891624-70891646 TTGGGGGAGGAGCAGTTAGAAGG + Intronic
1129360171 15:75019552-75019574 ATGAGGGAGGAGGAGGCTGAAGG - Exonic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1131651047 15:94400079-94400101 AAGAGGGAGGAAAAGTTTCAAGG - Intronic
1132120453 15:99170974-99170996 ATGGGGTAGGAATAGTTTGAGGG + Intronic
1132307595 15:100827454-100827476 ATGGGGGAGGAGGAGAGTGAAGG - Intergenic
1134252732 16:12585897-12585919 GTGTGGGTGGAGAAGTGTGTTGG - Intergenic
1135100916 16:19604697-19604719 ATGTGTGAAGAGAAATTTGGTGG + Intronic
1136247960 16:28985959-28985981 AGGTGGCAGGGGAAGTCTGAAGG - Intronic
1137466275 16:48712733-48712755 ATGTGGCAGAAGAAGATTTATGG - Intergenic
1137521741 16:49200863-49200885 ATGTAGGAGGAGATATTGGATGG - Intergenic
1138455441 16:57118047-57118069 ATGTGGGAGCAAAGGCTTGATGG - Intronic
1138485906 16:57343417-57343439 ATCAGTGAGGAGGAGTTTGAAGG + Intergenic
1141818960 16:86432105-86432127 AAATGGCAGGAGAAGTTTCAGGG + Intergenic
1142668804 17:1477907-1477929 CTGGTGGAGGAGAAGTTTAAGGG - Exonic
1143729724 17:8874275-8874297 ATGCGGGAGGGGCAGTCTGAAGG + Intergenic
1144635648 17:16907098-16907120 ATCTGTGAAGAGTAGTTTGATGG + Intergenic
1145980847 17:29010542-29010564 ATGTGGCAGGAGAAGTCCCAGGG + Intronic
1147020013 17:37523748-37523770 AGGTGGGGGGAGAAGGTGGATGG + Intronic
1147260730 17:39208592-39208614 ATGGGGGTGAAGAAGGTTGAAGG + Intergenic
1147388394 17:40095121-40095143 CTGGGGGAGGAAAAGATTGAAGG + Intronic
1147557550 17:41489037-41489059 ATGTGGAAGTTGAATTTTGAGGG - Intronic
1147998419 17:44374340-44374362 ATGTGGAAGGTGAGGTGTGAAGG - Exonic
1148150680 17:45395102-45395124 TGCTGGGAGGAGGAGTTTGATGG - Exonic
1149642169 17:58210098-58210120 ACCAGGGAGGAGAGGTTTGAGGG + Intronic
1151109303 17:71655904-71655926 GTGTGGGTGGAGAAGTTTTGAGG - Intergenic
1151378313 17:73707147-73707169 CTGGGGGAGGAGAAGGTTGGCGG - Intergenic
1151412040 17:73937366-73937388 ATGTGGCAGGAGTAGTTGGGTGG + Intergenic
1152209991 17:78997989-78998011 AGGTGGGAGGGGAAGGCTGACGG + Intronic
1155528472 18:26741935-26741957 AAGTGGGAAGATAAGTTTCAGGG - Intergenic
1156148662 18:34218194-34218216 ATATGGCAGGAGAACTTTCAAGG - Intronic
1157158657 18:45291886-45291908 ATCTGGGAGGAGAACTTTGAAGG - Intronic
1157521922 18:48351418-48351440 GTGAGGGAGGAGAAGTTTGCTGG - Intronic
1159465939 18:68784438-68784460 GTGTTGGAGGTGAGGTTTGATGG - Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160764568 19:801691-801713 CTGTGGGAGGCGAAGGTTGGAGG + Intronic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1161719738 19:5896189-5896211 ATGTGGGAGGAGCAGTGAGGAGG + Intronic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163448991 19:17364565-17364587 ATGTGGATGGAGAAGTTTATTGG - Intronic
1164357956 19:27464256-27464278 AAGTGAGAGGAGAAGTTTAGAGG + Intergenic
1164565270 19:29321474-29321496 ATGTGATTGGAGAATTTTGAAGG + Intergenic
1166001749 19:39881613-39881635 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1166004531 19:39897864-39897886 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1166323231 19:42032695-42032717 ACATGGGAGGAGCAGTTTGCTGG - Intronic
1166621184 19:44302229-44302251 ATTTGGGAAGAGAAGTTACATGG + Intronic
1167122535 19:47527198-47527220 ATGTGGCAGGAGGAGATTCAGGG + Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
928084329 2:28336437-28336459 ACGTGGGACTGGAAGTTTGAGGG + Intronic
928845044 2:35661379-35661401 CTTTGGGAGGCGAAGTTTGGCGG + Intergenic
929193272 2:39159763-39159785 ATGTGGGAGGCGAAGGTTGAAGG + Intergenic
929351238 2:40957907-40957929 ATGTTGGAGGAGGGGTTTGGGGG - Intergenic
929609139 2:43257028-43257050 ATCTGGGAAGAAAACTTTGAAGG - Intronic
929637618 2:43541248-43541270 ATGTTGTTGGAGAAGTATGAAGG - Exonic
929789359 2:45012207-45012229 ATGGGGGAGGAGGAGAATGAGGG - Intergenic
929891915 2:45925371-45925393 ATCTGGGAGGTGGAGTTTGCAGG - Intronic
930037895 2:47099320-47099342 AAGTGGGAGGAGAGGGTTCAGGG - Intronic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930679309 2:54239521-54239543 AAATGGGAGGAGAAGTGGGATGG - Intronic
931291634 2:60879442-60879464 ATGTTTGATGAGACGTTTGAAGG + Intergenic
932048078 2:68370209-68370231 ATGTGAAAAGAGAAATTTGAGGG + Intronic
932237154 2:70129708-70129730 ATGAGGGAGGAGTTGTTTCATGG - Intergenic
932522009 2:72423686-72423708 ATGTGTGAGTAGATGTTTGTAGG - Intronic
933129125 2:78651183-78651205 ATGAGGGTGGAGAAATTTGGAGG - Intergenic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933521428 2:83379821-83379843 ATGTTGGCGGAGAAGTCTGGTGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935362908 2:102262803-102262825 ATGAGGGAGGAGATGGGTGAAGG + Intergenic
935788525 2:106570467-106570489 ATGTGGGAGGAGAGCCCTGAAGG + Intergenic
936110981 2:109664525-109664547 ATGTGGGAGGAGGAGGTTGCAGG + Intergenic
936270240 2:111043507-111043529 AGGTGGGAGGAGAGGGCTGAGGG + Intronic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
938284412 2:130097066-130097088 ATGCAGGAGGAAAAGCTTGAGGG + Intronic
938335051 2:130485630-130485652 ATGCAGGAGGAAAAGCTTGAGGG + Intronic
938354774 2:130635038-130635060 ATGCAGGAGGAAAAGCTTGAGGG - Intronic
938431195 2:131241825-131241847 ATGCAGGAGGAAAAGCTTGAGGG - Intronic
938539743 2:132276073-132276095 ATGTGACAGGAGAAGTGTCAAGG + Intergenic
940273730 2:151917883-151917905 ATATGGAAGGAGAAGTTTAGGGG - Intronic
941052042 2:160746178-160746200 ATGTGGGAAAAGAACTTAGAAGG - Intergenic
941191751 2:162392946-162392968 ATGTGGGAAGGCAAGTTGGAAGG + Intronic
942473626 2:176290468-176290490 ATGTGGGATGAGATGTATGTAGG + Intronic
942635855 2:178004768-178004790 ATCTAGGAGGAAAAGTTTGGGGG - Intronic
943753523 2:191535003-191535025 GTGTGGGAGGAAAAGTATGGTGG + Intergenic
943824384 2:192370641-192370663 CTGAGTGAGGAGAACTTTGATGG - Intergenic
945281461 2:208039423-208039445 ATGTGGAAGAAAAAGATTGAGGG - Intergenic
945677571 2:212874252-212874274 ATGTGTGAGGAGCTTTTTGAAGG + Intergenic
945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG + Intronic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
947326034 2:228977988-228978010 ATTTGGGAGGAAAAGTCTCAGGG - Intronic
947541999 2:230986040-230986062 AGGTGGGAGGTGAAGGGTGAGGG + Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
1169883752 20:10375353-10375375 ATGTGGAAGAAGAAGATTTATGG - Intergenic
1170155773 20:13267978-13268000 ATGTTGTTGGAGAAGTTTTAGGG + Intronic
1171330377 20:24332193-24332215 ATGTGGGAGGGGAATGGTGATGG + Intergenic
1172341117 20:34158466-34158488 AGGTGGGAGGATCAATTTGAGGG + Intergenic
1173332183 20:42084712-42084734 AAGTGGCAGGAGCAGTATGACGG - Exonic
1173430479 20:42983189-42983211 ATGTAAGAGGAGATGTTTAAGGG - Intronic
1173982075 20:47232295-47232317 ATCTGGGAGGAAGAGTTTGCAGG + Intronic
1174605703 20:51759857-51759879 ATTTGGGATTACAAGTTTGAGGG - Intronic
1175467780 20:59204080-59204102 ATGAGCGAGGAGAAGATTGCAGG + Intronic
1177679578 21:24348683-24348705 ATGTGGTGGGAGAAGATTTATGG + Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178973279 21:37200133-37200155 TTGTGGCAGAAGATGTTTGAAGG + Intronic
1179520543 21:41941276-41941298 ATTTGGGCCCAGAAGTTTGAGGG + Intronic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1181620064 22:24084978-24085000 AGGTGAGAGGAAAAGTATGAGGG - Intronic
1182654502 22:31879300-31879322 GGGTGGGAGGAGGAGTTGGAAGG - Intronic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183097976 22:35565749-35565771 GAGGGGGAGGAGAAGTTGGAGGG - Intergenic
1184221958 22:43106575-43106597 ATGGAGGAGGAGATATTTGAGGG - Intergenic
1184244551 22:43229210-43229232 AAGTTGGGGGAGGAGTTTGAGGG + Intronic
1184956389 22:47889575-47889597 ATGTTGGAGGTGAAGTCTGGCGG + Intergenic
951682062 3:25305254-25305276 CTGTAGGAGGAGAGGTTTTAAGG + Intronic
951900810 3:27655964-27655986 ATGTGGGAGGAAAAGGTAAAAGG - Intergenic
951955614 3:28249948-28249970 ATGGGGGAAGAGGAGGTTGAGGG + Intronic
953614581 3:44478249-44478271 ATCTGGGAGGAGTAGGTTGGGGG + Intergenic
954157247 3:48692901-48692923 ATGTGGGAGGGGAAGTGTTGGGG - Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
955154430 3:56402599-56402621 TGGTGGGAGGAGAAGTGAGATGG - Intronic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
959149574 3:102592061-102592083 ATGTTGGAGGAGGGGTGTGATGG + Intergenic
959240684 3:103788779-103788801 ATGCGGGAGGAGAAAACTGAAGG - Intergenic
959792229 3:110375631-110375653 ATGTGAGAGGAGATTTGTGAAGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959945418 3:112120592-112120614 ATGAGGGAGGAGGAGTTTTCTGG + Intronic
960070283 3:113422660-113422682 ATGTGAGAGCAGTGGTTTGAAGG - Intronic
960116013 3:113893318-113893340 ATGTGGGTGGAGAGGTGGGAAGG - Intronic
960347778 3:116556208-116556230 ATTTGGGTGAAAAAGTTTGATGG + Intronic
960455003 3:117860204-117860226 ATGTGGGAGGGGACGTCAGAAGG - Intergenic
961862094 3:129925364-129925386 ATGTTGCAGGTGAAGTCTGAAGG - Intergenic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962386566 3:134937060-134937082 ATGTGGGAGCTGAATTTTAAAGG + Intronic
963235875 3:142955350-142955372 ATGTGGAAAGTGAAGTTTCAAGG + Intronic
964559471 3:157977771-157977793 ATGTGTGTGGACAATTTTGATGG - Intergenic
964996098 3:162883004-162883026 GTGGGGGAAGAGAATTTTGAAGG + Intergenic
965689223 3:171337561-171337583 ATAAGGGAGCAGAAGTTTCATGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
965959655 3:174413737-174413759 ATTTGGGAGGAGGAGGTAGAGGG + Intergenic
966956260 3:184883424-184883446 ATGTGGGAAGAGGTGTTAGAAGG - Intronic
968919876 4:3516964-3516986 AGGTGGGAAGAGAAGTGTGTGGG + Intronic
969965492 4:10990188-10990210 ATGAGGAATGAGAAATTTGACGG + Intergenic
972658205 4:41087535-41087557 ATGTGGGAGGCTGAGTTGGAAGG - Intronic
972683908 4:41333206-41333228 ATGTTGGAGGAGGGGTTTGGTGG - Intergenic
976177986 4:82373656-82373678 ATGTCGGAGGAGCAGTTCGGCGG - Exonic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
977474846 4:97492661-97492683 ATTTGTGAGGAGAAATTTGGGGG + Intronic
978294735 4:107191738-107191760 ATGTGGTAGAAGAAGATTTATGG + Intronic
978428758 4:108610092-108610114 ATATGAGAGGAAGAGTTTGAAGG + Intergenic
979095756 4:116548152-116548174 ACATGGGAGGAGAGGTTTGTGGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
981580894 4:146247519-146247541 AAGTGGGATGTGAAGGTTGAGGG + Intergenic
982813008 4:159849795-159849817 ATTTGGGACAAGAAATTTGATGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
985050136 4:185982048-185982070 ATGTGGTAGAAGAAGATTTATGG - Intergenic
986107068 5:4670149-4670171 ATGTTGGGGGAAAAGTTTGGTGG - Intergenic
986375088 5:7122774-7122796 GGGTGGGAGGAGATGTCTGAGGG - Intergenic
986686171 5:10276966-10276988 ATGTGGGAGGTGAACTGTAAAGG + Intronic
987218629 5:15766217-15766239 ATGAGGGAAAAGAAGTTTCATGG - Intronic
987314088 5:16708149-16708171 AGTTGGGAGTAGAAGTTGGATGG - Intronic
988744841 5:34124630-34124652 ATGTTGGAGGTGGAGTGTGATGG - Intergenic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
991251372 5:64565612-64565634 ATGTGGTGTGAGAAGTTGGAAGG - Intronic
992376728 5:76195187-76195209 ATATGGAAGGAGATGTGTGAAGG - Intronic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993115932 5:83721037-83721059 ATTTGGGAGGAGAACTTTCCTGG - Exonic
994137094 5:96301292-96301314 ATGTTGGAGGAGGGGTTTGTTGG - Intergenic
995151764 5:108855669-108855691 ATGTGGGAAGATAGGTTTCAAGG + Intronic
995238305 5:109856428-109856450 ATGTGGGAGGATAAATTTATGGG + Intronic
995762996 5:115583854-115583876 ATGGAGGAGGAGAACTTTAAAGG - Intronic
996916813 5:128721965-128721987 ACCTGGGAGGTGAAGGTTGAAGG + Intronic
996992461 5:129651437-129651459 ATGAGGCAGGAGAAGTTAAAGGG - Intronic
996997594 5:129716755-129716777 CTGTGGGAGGAGGAGTATGCAGG - Intronic
997124733 5:131214432-131214454 GTGAGGGAGGAGTACTTTGAGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998475831 5:142420807-142420829 ATGTGGAGGGAGAAACTTGAAGG - Intergenic
998480313 5:142457800-142457822 GTGTTGGAGGAGGGGTTTGATGG + Intergenic
998728914 5:145051539-145051561 ATATGGGATCAGAAGTTTAATGG + Intergenic
999848858 5:155515672-155515694 ATGTGGTAGAAGAAGATTTATGG + Intergenic
1000119213 5:158180566-158180588 ATGAGGGACGAGAAGTTTGTTGG + Intergenic
1000323192 5:160151324-160151346 ACCTGGGAGGAGGAGTTTGCAGG - Intergenic
1000635355 5:163637743-163637765 AAGTAGGAGGAGTATTTTGAGGG + Intergenic
1002493953 5:179599376-179599398 ATGTGGTAGGAGATGTTTACTGG - Intronic
1002939334 6:1702479-1702501 ATGTGGGAGGAGTAGTTAGGAGG + Intronic
1003268709 6:4588992-4589014 GTGTGGGAGGAAAGCTTTGAAGG - Intergenic
1004256278 6:14067804-14067826 CTGTGGGTGGAGCAGTTGGAAGG - Intergenic
1004308483 6:14522633-14522655 ATGTTGGATGAGAAGTTCAAGGG - Intergenic
1004438167 6:15617959-15617981 TTGTGGGATGAGTAGTTTGTAGG - Intronic
1005159460 6:22842297-22842319 AAATGGGAGGGGAGGTTTGAGGG + Intergenic
1005277370 6:24234201-24234223 ATGAGGAAGGAGAATTTTAAAGG + Intronic
1005597743 6:27395243-27395265 ATGTTGGAGGTGAAGCCTGATGG + Intronic
1005968736 6:30744601-30744623 CTGCGGGAGGAGGAGTTAGAAGG - Intergenic
1006349265 6:33509148-33509170 CTGTGGGAGGAGCAGGTTTATGG - Intergenic
1008419193 6:51277081-51277103 AGGTGTGAGGACCAGTTTGAAGG + Intergenic
1008450090 6:51641229-51641251 ATGTGTGAGGACTAGTTTGAGGG - Intronic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1010766512 6:79781806-79781828 AGGTGGGAGAAGAAGGGTGAAGG + Intergenic
1010920227 6:81672231-81672253 ATGTGGCTGGAGAAGCTTCACGG + Intronic
1011396361 6:86913333-86913355 ATGAAGGAGGTGAAGCTTGAGGG + Intergenic
1012034274 6:94111550-94111572 ATGTGGGAGGTGAGGTTTGGTGG + Intergenic
1012160904 6:95885094-95885116 ATGTGGGTGGAGGAGTTGGGAGG + Intergenic
1012244072 6:96906591-96906613 ATGTGGGAGGTTAAGTTTTTTGG + Intergenic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012686017 6:102250546-102250568 ATGTTGGAGGTGAGGTTTGGTGG + Intergenic
1013205147 6:107938184-107938206 ATGTGGGAGAAGTAGAATGAAGG - Intronic
1013582131 6:111545832-111545854 ATGTTGGAGGAGGGGTCTGATGG + Intergenic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1015724353 6:136285369-136285391 ATCTGGGAGGACAAGTTTGGGGG + Intronic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1017554448 6:155547848-155547870 TTATGGGAGGATAAGTTTGGGGG - Intergenic
1018435599 6:163755662-163755684 ATTTGGGAGCAGAACGTTGAAGG - Intergenic
1018690441 6:166339983-166340005 CTGTGGGAGGAGCAGGTTCAGGG - Intronic
1019427118 7:983077-983099 ATGTGGAACGAGCAGTTTGCAGG - Intergenic
1020790492 7:12621546-12621568 ATATGTGAGGAGATCTTTGATGG + Intronic
1020811485 7:12854783-12854805 AGGTGGGAGGGGAAGTTAGAGGG + Intergenic
1021361211 7:19714809-19714831 ATGTGGTACGGAAAGTTTGAGGG + Intergenic
1022556884 7:31306871-31306893 ATGTGGCTGGAGAAGTATGAGGG + Intergenic
1022656182 7:32321342-32321364 ATGTAGGAGGAGAAGAATCAAGG + Intergenic
1023298980 7:38747889-38747911 ATGTGGGAAGAAATGTCTGAAGG + Intronic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1024247909 7:47484429-47484451 ATAAGGGAGGAAAAGTGTGACGG - Intronic
1026142313 7:67716829-67716851 ATGTGGTGGGAGAAGATTTATGG + Intergenic
1028228197 7:88274436-88274458 ATGAGGGAGGTGAAGGATGAAGG - Intergenic
1028792953 7:94874246-94874268 ATGTGGGAGGTGGAGGTTGCAGG + Intergenic
1029013459 7:97287891-97287913 ACGTGGGAGGTGGAGGTTGAAGG + Intergenic
1031357061 7:120800240-120800262 ATGTGGGATGGGCTGTTTGAGGG - Intronic
1032977065 7:137237664-137237686 AGCTGGGAGGACATGTTTGAAGG - Intronic
1033239195 7:139663187-139663209 AACTGGGAGGAGAAGCTTCATGG - Intronic
1033981925 7:147175728-147175750 GTGTGGGAGTAGAAGGTTGATGG + Intronic
1034041281 7:147879842-147879864 ATGTGAGTGGAGCTGTTTGAGGG + Intronic
1034330396 7:150277684-150277706 AAGTGGGAGGAAAAGGTTCAGGG - Intronic
1034527926 7:151677825-151677847 ATGTGGTGGAAGAAGATTGATGG - Intronic
1034667647 7:152832164-152832186 AAGTGGGAGGAAAAGGTTCAGGG + Intronic
1034905289 7:154939385-154939407 AGGTGAGATGAGAATTTTGATGG - Intronic
1035495060 7:159317466-159317488 ATGTGGTAGAAGAAGATTTATGG - Intergenic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1037751197 8:21683460-21683482 ATGCAGGAGGGGGAGTTTGAGGG + Intergenic
1038879173 8:31588581-31588603 CTGTGGGATGAGATGTTTTAGGG + Intergenic
1038893060 8:31748890-31748912 ATCTGAGAGGAGAAATTTGAGGG - Intronic
1039051978 8:33503440-33503462 ATGTTGCATGAGAAGTTTTAGGG + Exonic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041648574 8:60279084-60279106 AAGTGGTAGGAGAAGTTTCATGG + Intronic
1043379487 8:79687395-79687417 ATATGGGATGAGAAGTGTCAAGG + Intergenic
1043927338 8:86052253-86052275 ATTTGGGAGGAGAAATTCTAAGG - Intronic
1046913290 8:119652411-119652433 ATGTGGGATGAATAGATTGAGGG - Intronic
1048224606 8:132572968-132572990 TTGTGGGAGGAGAGGTTGGTGGG - Intronic
1048454217 8:134563480-134563502 TTGTGGGAGGTGAATTTTCATGG - Intronic
1048811928 8:138296281-138296303 AGATGGGAGGATAAGTTTGAAGG - Intronic
1048854784 8:138677100-138677122 ATGTGGGAGGAGGAGCCTAAAGG + Intronic
1049129075 8:140820694-140820716 TTGTGAGAGGAGCAGTTTGGTGG + Intronic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1049714443 8:144083224-144083246 ATGGTGGAGGAGCAGTTTGCGGG + Exonic
1050290525 9:4149412-4149434 ATGTGGGAGGTGATGGTTAAGGG - Intronic
1052147314 9:25065997-25066019 GTGTTGGAGGAGAGGTCTGATGG - Intergenic
1053111820 9:35467552-35467574 ATGTGGGAGGAAAAGTGAAATGG - Intergenic
1056505830 9:87257483-87257505 ATGTGGCATGTGAACTTTGATGG + Intergenic
1056957731 9:91095968-91095990 ATGTTGGAGGAGAAGGTTTGTGG - Intergenic
1057080818 9:92173211-92173233 AGGTTTGAGGAGGAGTTTGAGGG + Intergenic
1057153097 9:92812276-92812298 AGGTGGGAGGAAAAGCTTCAAGG - Intergenic
1059260997 9:112976514-112976536 ATGTTGGAGGTGAGGTTTGGTGG + Intergenic
1059927878 9:119229776-119229798 ATGTGGGATAAGAAGTGTAAGGG + Intronic
1061394028 9:130333525-130333547 ATGAGAGTGGAGAGGTTTGAGGG - Intronic
1061463838 9:130762064-130762086 ACCTGGGAGGCGAAGTTTGTGGG + Intronic
1061503002 9:131014295-131014317 AGGTGGGAGGAGAAGTGCGCTGG - Intronic
1061531854 9:131220560-131220582 ATGTGGAAGGAAGAGGTTGAAGG + Intronic
1062591282 9:137275935-137275957 ATTTGGGAGGAGAAGTGGGGAGG + Intergenic
1185772877 X:2778848-2778870 ACCCGGGAGGAGAAGTTTGCGGG - Intronic
1186001937 X:5022288-5022310 GTGTTGGAGGAGAGGTTTGGTGG + Intergenic
1186031567 X:5374661-5374683 ATGTGGTAGAAGAAGATTTATGG - Intergenic
1186253128 X:7690719-7690741 ATCTGGAAGGATAAGGTTGATGG - Intergenic
1187757351 X:22542413-22542435 AAGTGGGAGGAGATATTTGAAGG - Intergenic
1188711122 X:33400032-33400054 ATGTAGGTGGAGAGGTTTCAAGG + Intergenic
1188980377 X:36721734-36721756 ATGTCTGAGGTGGAGTTTGAAGG + Intergenic
1190006468 X:46744226-46744248 AGGTAGGAGGAGAAGTATGTGGG - Intronic
1190443915 X:50503905-50503927 TTCTGGGAGGAGAAGATGGAAGG + Intergenic
1192337662 X:70235546-70235568 ATGATAGAGGAAAAGTTTGAAGG + Intronic
1193729532 X:85086410-85086432 ATGTGGGAGAAGCAGGTTTAGGG - Intronic
1194401434 X:93441663-93441685 ATGTTGGAGGAGGAATTTGATGG + Intergenic
1194723643 X:97369392-97369414 CTGAGGGAGGAGAGGTTTAAAGG + Intronic
1196108194 X:111918334-111918356 GTGAGGGAGGAGAAGTTGGCAGG + Intronic
1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG + Intergenic
1199675586 X:150186543-150186565 TCGTGGGAGATGAAGTTTGAAGG + Intergenic
1200143136 X:153911831-153911853 AGGTGGGAGGTGAAGGTTGCAGG + Intronic
1201469923 Y:14321961-14321983 ATCTGGAAGGATAAGGTTGATGG - Intergenic
1201596703 Y:15678449-15678471 CTTTGGGAGGACAAGTTGGAAGG + Intergenic
1202099653 Y:21293966-21293988 ATGTTGGAGGAGGAATTTGTGGG - Intergenic
1202127496 Y:21581390-21581412 AAGGAGGAGGAGAAGTTTCAGGG + Intergenic