ID: 915797551

View in Genome Browser
Species Human (GRCh38)
Location 1:158752522-158752544
Sequence CACCCCAACTCGGAAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 14, 3: 43, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915797546_915797551 -10 Left 915797546 1:158752509-158752531 CCTGGGGTGCTCCCACCCCAACT 0: 1
1: 5
2: 28
3: 57
4: 318
Right 915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG 0: 1
1: 0
2: 14
3: 43
4: 270
915797545_915797551 -9 Left 915797545 1:158752508-158752530 CCCTGGGGTGCTCCCACCCCAAC 0: 1
1: 0
2: 2
3: 22
4: 259
Right 915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG 0: 1
1: 0
2: 14
3: 43
4: 270
915797541_915797551 22 Left 915797541 1:158752477-158752499 CCTGGGTCTGCAACAGTGGCTTG 0: 1
1: 0
2: 7
3: 62
4: 316
Right 915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG 0: 1
1: 0
2: 14
3: 43
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915797551 Original CRISPR CACCCCAACTCGGAAGGCGC AGG Intergenic
900165012 1:1241059-1241081 CACGCCAACCAGGAAGGTGCAGG + Intergenic
900396116 1:2453895-2453917 CCACCCCACTCGGCAGGCGCAGG - Intronic
901691042 1:10973671-10973693 CGTCCCAACTCAGAAGGGGCGGG - Intronic
901759698 1:11462729-11462751 CACCCCAGCTGGGAAGGAGGAGG - Intergenic
902178427 1:14669166-14669188 CACCCCAACTTGGGAAGCCCTGG + Intronic
902644892 1:17791193-17791215 TGCCCCAACTCGGAAGGGGCAGG + Intronic
903082215 1:20820028-20820050 CATCCCAACTCAGAAGGGGCAGG - Intronic
903672263 1:25043384-25043406 CGCCCCAACTCAGAAGGGGGTGG + Intergenic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
903724584 1:25431190-25431212 CACCCCCACTCCGCGGGCGCGGG + Intronic
904369941 1:30042090-30042112 CCCACCAACTCTGAAGGGGCAGG - Intergenic
906448389 1:45922744-45922766 CCCACCAACTCGGAAGGGGTGGG + Intronic
907152837 1:52305607-52305629 CCCACCAACTCGGAAGGGGTGGG - Intronic
907223257 1:52922404-52922426 CACTTGAACTCGGAAGGCACAGG + Intronic
908375728 1:63538535-63538557 CACTCGAACTCGGGAGGCGGAGG - Intronic
911539934 1:99146342-99146364 CACTCCAACTTGGATGGGGCGGG - Intergenic
912790433 1:112644272-112644294 CACCTCAACCCGGAAGGTGGAGG - Intronic
915309948 1:155001840-155001862 CACCCCCTCTCGGAGGGAGCCGG - Intergenic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918267755 1:182861730-182861752 CACCCCAAATCAGAAGACACAGG - Intronic
919165447 1:193885644-193885666 TATCCCAACTCAGAAGGGGCAGG + Intergenic
919191914 1:194230967-194230989 CACCCCAACTCAGAAGGGGCGGG + Intergenic
919314072 1:195948675-195948697 CACACCAACTCAGAAGATGCAGG + Intergenic
920269405 1:204752048-204752070 CGTCCCAACTCAGAAGGGGCGGG - Intergenic
921902167 1:220462899-220462921 CATCCCAACTCAGAAGGGGCGGG - Intergenic
922642263 1:227245876-227245898 CACCACAACTGGGAATGTGCTGG - Intronic
923058866 1:230451954-230451976 CACCCGAACTCAGAAGGCGGAGG + Intergenic
923755159 1:236785389-236785411 CTCACCAACTCAGAAGGGGCAGG - Intergenic
923823485 1:237473629-237473651 GACCCAAACTAGGAAGGAGCGGG + Intronic
924727531 1:246684269-246684291 CACCTGAACTCTGGAGGCGCAGG - Intergenic
1062874970 10:935800-935822 CACTTGAACTCGGTAGGCGCAGG - Intergenic
1064078000 10:12285796-12285818 CCCACCTACTCGGAAGGCTCAGG - Intergenic
1064521706 10:16209720-16209742 CACCACAGCTGGGAATGCGCTGG + Intergenic
1064554312 10:16533397-16533419 CACCTCAACTGGGGAGGCGGAGG - Intergenic
1064748711 10:18503510-18503532 CACTTCAACTTGGAAGGCGGAGG + Intronic
1068060789 10:52064733-52064755 CATCCCAACTCAGAAGGGGTGGG + Intronic
1068967242 10:62924718-62924740 CGCCCCAACTCAGAAGGGGCGGG + Intergenic
1069561902 10:69436364-69436386 CCCGCCAACTCGGAAGGAGGTGG + Intergenic
1069576069 10:69529242-69529264 CACCGCAACTCAGAAGGAGCAGG + Intergenic
1069724479 10:70568521-70568543 CACCCTTACTCTGAAGGGGCAGG - Intergenic
1072335697 10:94395959-94395981 CACCCCAGCTCAGAAGGGGTGGG + Intergenic
1072470371 10:95707378-95707400 CACCCCAATTCAGAAAGGGCAGG + Intergenic
1072828499 10:98632888-98632910 CACCCGTACTCAGAAGGCACAGG - Intronic
1073125304 10:101145627-101145649 CACCCCAGGGCGGAAGGCTCAGG - Intergenic
1075007601 10:118842110-118842132 CACCCCAACTTGGAAGGGGCTGG - Intergenic
1076823868 10:132957614-132957636 CATCCCATCTCTGAAGGCGCTGG + Intergenic
1078042899 11:7884569-7884591 AACCCCAACTCGGAACAGGCAGG + Intergenic
1078607278 11:12788044-12788066 CACCCGAACTCTGGAGGCGGAGG - Intronic
1079472451 11:20790783-20790805 TACCCCAACTTGGAAGGGGCGGG + Intronic
1080992322 11:37552496-37552518 AACCCCAGCTCGGAAAGCACAGG + Intergenic
1082750196 11:57006454-57006476 CACCCTAATTCGAAAGGGGCAGG + Intergenic
1083696507 11:64446835-64446857 CACCTGAACTCGGCAGGCGGAGG - Intergenic
1084333451 11:68443740-68443762 CACTCCAACCCGGGAGGCGGAGG - Intronic
1084991014 11:72925807-72925829 CGTCCCAACTCAGAAGGGGCAGG - Intronic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1085178434 11:74511179-74511201 CACCACAGCTGGGAAGGTGCTGG - Intronic
1087036102 11:93758232-93758254 AGCGCCAACTCGGAAGGGGCAGG - Intronic
1087844366 11:102955627-102955649 CACCACCACTGGGAAGGGGCAGG + Exonic
1088315718 11:108504581-108504603 CACTCGAACTCGGAAGGCAGAGG - Intergenic
1088513092 11:110598777-110598799 CACCCCAACTCAGAAGGGGCAGG - Intronic
1089505949 11:118961855-118961877 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1089529988 11:119121471-119121493 CACCAAAACACGGAAGGGGCGGG - Intergenic
1089823017 11:121246084-121246106 CGCCTCAACTCAGAAGGGGCGGG - Intergenic
1091325666 11:134685180-134685202 CACCCCTCCTCAGAAAGCGCTGG - Intergenic
1094818073 12:34205612-34205634 CATCCCCACTCGGAGGCCGCGGG - Intergenic
1095042174 12:37455432-37455454 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1096602775 12:52742233-52742255 CCCACCAACTTGGAAGGGGCGGG - Intergenic
1097078299 12:56410987-56411009 CATCCCAACTCAGAAGGGACAGG + Intergenic
1097193137 12:57229759-57229781 CATCGCAACTCGGAAGTCGCAGG - Exonic
1098597996 12:72295256-72295278 CACCCCAGCTCAGAAGGGGCAGG + Intronic
1099911936 12:88844651-88844673 CACCCCAACTCAAAAGGGGTGGG + Intergenic
1100303273 12:93327056-93327078 CACCTCAACTCGGGAGGCGGAGG + Intergenic
1101764135 12:107682790-107682812 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
1102454931 12:113065436-113065458 ACCCCCAGCCCGGAAGGCGCGGG - Intronic
1102892938 12:116575094-116575116 CACTCCAACCCAGAAGGCGGAGG + Intergenic
1105640034 13:22252704-22252726 CCCACCAACTCTGAAGGGGCGGG - Intergenic
1106821036 13:33464763-33464785 CACTTGAACTCGGAAGGCGGAGG + Intergenic
1107513431 13:41107268-41107290 CATCCCAACTTAGAAGGGGCCGG - Intergenic
1108240471 13:48458083-48458105 TGTCCCAACTCGGAAGGGGCGGG + Intronic
1109291970 13:60487390-60487412 CACTTGAACTCGGAAGGCGGAGG + Intronic
1110442191 13:75538159-75538181 CAACCAAATTCGGAAGGCGCTGG + Intronic
1110724232 13:78801196-78801218 CACCTGAACTCGGGAGGCGGAGG - Intergenic
1110999987 13:82165767-82165789 CCTGCCAACTCGGAAGGGGCGGG + Intergenic
1111512814 13:89287908-89287930 CACCCCTACTCAGAAGTGGCAGG + Intergenic
1113339035 13:109404362-109404384 CGCCCCAACTCAGAAGGGGCAGG - Intergenic
1115120240 14:29928507-29928529 CACCCCAGCTCCTAAGGCACCGG + Intronic
1116257109 14:42570921-42570943 CACTCCAACTCAGAAGGGGCAGG - Intergenic
1117233969 14:53752286-53752308 CACCACAACTGGGAATGTGCTGG - Intergenic
1118405879 14:65423067-65423089 CACTTGAACTCGGAAGGCGGAGG - Intronic
1119416449 14:74473299-74473321 CACTTGAACTCGGAAGGCGGAGG + Intergenic
1119618081 14:76111891-76111913 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1120889654 14:89480317-89480339 CACTTCAACTCGGGAGGCGGAGG + Intronic
1122826051 14:104371135-104371157 CAGCCCACTTCAGAAGGCGCTGG - Intergenic
1123675924 15:22710345-22710367 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1123676011 15:22710801-22710823 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1123722105 15:23068967-23068989 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1123734776 15:23175132-23175154 CACCCAAACCCGGGAGGCGGAGG + Intergenic
1123753138 15:23373788-23373810 CACCCAAACCCGGGAGGCGGAGG + Intergenic
1123753206 15:23374203-23374225 CACCCAAACCCGGGAGGCGGAGG + Intergenic
1123764755 15:23466856-23466878 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1123781654 15:23634323-23634345 CACCCCAGCAGGGAAGGTGCAGG - Intergenic
1124150121 15:27169661-27169683 CACTCCATCTCGGCAGGCTCAGG + Intronic
1124285278 15:28396434-28396456 CACCCAAACCCGGGAGGCGGAGG + Intergenic
1124297418 15:28515192-28515214 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1124327920 15:28783271-28783293 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1124328212 15:28784716-28784738 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1124574694 15:30896999-30897021 CACCCAAACCCGGGAGGCGGAGG + Intergenic
1124650338 15:31469363-31469385 CCCACCAACTTGGAAGGGGCGGG + Intergenic
1125381748 15:39093076-39093098 CACCCCAACTTAGAAGGGGCAGG + Intergenic
1125809292 15:42523898-42523920 CACTTGAACTCGGAAGGCGGAGG - Intronic
1126292771 15:47100090-47100112 CATTCCAACTCGGAAGGGGCAGG + Intergenic
1126716137 15:51519724-51519746 CACTTGAACTCGGGAGGCGCAGG - Intronic
1128020783 15:64388388-64388410 CACCTGAACCCGGAAGGCGGAGG - Intronic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1129784911 15:78303816-78303838 CTCCCCAACTCAGAAGGGGGAGG - Intergenic
1130183029 15:81651182-81651204 CACCCCAAGTCAGAAAGGGCAGG - Intergenic
1133041922 16:3065412-3065434 CACCCCAGCTCAGAGGGAGCAGG + Exonic
1133226182 16:4341555-4341577 GCCACCAACTCGGAAGGCCCAGG - Intronic
1135138244 16:19900507-19900529 CACCTGAACCCGGAAGGCGGAGG + Intergenic
1137334509 16:47534076-47534098 CACCCAAGCTCGGAAGGGGTGGG + Intronic
1137698587 16:50479045-50479067 CTTCCCAACTCAGAAGGGGCGGG + Intergenic
1138014158 16:53413851-53413873 CACCCAAACCCGGGAGGCGGAGG - Intergenic
1138593310 16:58015218-58015240 CACCACAACTGGGATGGAGCTGG - Intronic
1138844945 16:60554262-60554284 CACCACAACTAGGAATGTGCTGG + Intergenic
1140419653 16:74807775-74807797 TGCCCCAACTCAGAAGGAGCGGG + Intergenic
1140828256 16:78727313-78727335 CACTTCAACCCGGAAGGCGGAGG + Intronic
1141700511 16:85640038-85640060 CAGCCCACCTGGGAAGGCTCTGG - Intronic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142817980 17:2442909-2442931 TACCTCAACCCGGAAGGCGGAGG - Intronic
1143526370 17:7475255-7475277 CACCTGAACCCGGAAGGCGGAGG + Intronic
1144437326 17:15253595-15253617 CACCCCCACTAGGAAGGAGTTGG - Intronic
1144495621 17:15743090-15743112 CCCCCCAACCCGGATGGAGCAGG - Intronic
1144539238 17:16123045-16123067 CACCCCAACTCCAAAGACTCAGG + Intronic
1144695358 17:17300822-17300844 CCCGCCAACTCAGAAGGGGCGGG - Intergenic
1144714364 17:17424022-17424044 CCCACCAACTCAGAAGGGGCGGG - Intergenic
1147882258 17:43661443-43661465 AACCCCCACTCGGAAGGCAATGG - Exonic
1148168082 17:45497780-45497802 CCCAACAACTCGGAAGGCTCAGG + Intergenic
1148280734 17:46345180-46345202 CCCAACAACTCGGAAGGCTCAGG - Intronic
1148302962 17:46563115-46563137 CCCAACAACTCGGAAGGCTCAGG - Intronic
1149160521 17:53687266-53687288 CCCACCAACTCAGAAGGGGCAGG + Intergenic
1150168347 17:62966171-62966193 CACCCCAGCCCGGAGGGGGCGGG + Intergenic
1150192777 17:63260647-63260669 CACGCCTACTCGGAAGGCTAAGG + Intronic
1150950776 17:69800963-69800985 CGCCCCAACTTGGAAGGGGTGGG - Intergenic
1151030522 17:70732666-70732688 CAGCCCAGCTCAGAAGGCTCAGG + Intergenic
1151395482 17:73820017-73820039 CCCACCAACTTGGAAGGGGCAGG + Intergenic
1153486530 18:5604535-5604557 CACTTGAACTCGGAAGGCGGAGG - Intronic
1154308163 18:13245535-13245557 CAGCCCAAGTCAGAAGGCTCAGG + Intronic
1154507852 18:15060545-15060567 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1155959450 18:31981898-31981920 CACCTCAACTCGGGAGGCGGAGG - Intergenic
1156244582 18:35284991-35285013 CCCGCCAACTTGGAAGGAGCTGG + Intronic
1157862784 18:51156401-51156423 CACTTGAACTCGGAAGGCGGAGG - Intergenic
1159186567 18:64983570-64983592 CACCCCAACTTGGAAGAGGTAGG - Intergenic
1159519241 18:69496344-69496366 CCCACCAACTCGGAAGGGGCGGG + Intronic
1161163182 19:2771899-2771921 CAGCCCAGCCCGGAAGGAGCAGG - Intronic
1161706968 19:5826737-5826759 CCCCCAAACTCGGAAGCCCCGGG - Intronic
1161780035 19:6285922-6285944 CACCCCAATGCAGAAGGGGCGGG - Intergenic
1161781677 19:6297337-6297359 CATCCCAACTCAGGAGGGGCGGG - Intergenic
1165022498 19:32935988-32936010 CCCACCAACTCAGAAGGGGCAGG - Intronic
1165040969 19:33067067-33067089 CACTCAAACTCGGGAGGCGGAGG + Intergenic
1165358397 19:35318452-35318474 CACCTGAACTCGGGAGGCGGAGG - Intergenic
1165692401 19:37873809-37873831 CACCTGAACTCGGGAGGCGGAGG + Intergenic
1166757551 19:45202730-45202752 CACCACAGCTGGGAATGCGCTGG + Intronic
1166897293 19:46032184-46032206 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1167013022 19:46821543-46821565 CACCACAGCTCAGAAGGGGCAGG - Intergenic
1167234925 19:48308658-48308680 CATCCCAACTCAGAAGGGTCAGG - Intronic
1167234992 19:48308951-48308973 CCCACCAACTCGGAAGGGGCAGG - Intronic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
1168303275 19:55419293-55419315 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
925384751 2:3454314-3454336 CTACCCAGCTGGGAAGGCGCAGG - Intronic
925384771 2:3454383-3454405 CTACCCAGCTGGGAAGGCGCAGG - Intronic
925384810 2:3454521-3454543 CTACCCAGCTGGGAAGGCGCAGG - Intronic
925760401 2:7179179-7179201 CACCCGAACCCGGCAGGCGGAGG - Intergenic
926859416 2:17292370-17292392 CACCCCAACTCAGAAGGGGCAGG + Intergenic
928131839 2:28657457-28657479 CGCCCCATCTGGGAAGGCTCTGG - Intergenic
928578403 2:32679905-32679927 CACCTCAACCCGGAAGGCGGAGG + Intronic
930170147 2:48243534-48243556 CACCACTACTCGGAAGGCTGAGG + Intergenic
930176317 2:48304873-48304895 CACTCCAACCCGGGAGGCGGAGG - Intergenic
931499903 2:62854867-62854889 AGCCCCAACTCAGAAGGGGCGGG - Intronic
932885267 2:75543574-75543596 CACCCCACCCCGCAAGGAGCTGG + Intronic
933755945 2:85638620-85638642 CACCTGAACTCGGGAGGCGGAGG - Intronic
933910314 2:86934919-86934941 CGCCCGAACTCGGGAGGCGGAGG - Intronic
934022413 2:87968490-87968512 CGCCCGAACTCGGGAGGCGGAGG + Intergenic
935518902 2:104078980-104079002 CACTTCAACTCAGAAGGAGCAGG + Intergenic
936400728 2:112162547-112162569 AACTTCACCTCGGAAGGCGCAGG + Intronic
936413876 2:112286519-112286541 CGCCCGAACTCGGGAGGCGGAGG - Intronic
936511193 2:113149045-113149067 CACCACAACTTGGAATGCACTGG + Intergenic
938157804 2:128956392-128956414 CACCCCAACTCCGCAGCAGCAGG - Intergenic
939477576 2:142706424-142706446 CCCCCCAACTCAGAAGGCTGAGG + Intergenic
941151298 2:161918874-161918896 CCCACCAACTCAGAAGGCGCGGG - Intronic
941909995 2:170755568-170755590 CACCTGAACTCGGGAGGCGGAGG + Intergenic
943023560 2:182602260-182602282 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
943345771 2:186735081-186735103 CCCACCAACTCGGTAGGGGCAGG + Intronic
943858296 2:192827923-192827945 CACTCCAACTTGGAAGGTGGCGG - Intergenic
947327446 2:228993209-228993231 CCCACCAACTTGGAAGGGGCAGG + Intronic
947411103 2:229840616-229840638 CACCTGAACCCGGGAGGCGCAGG + Intronic
948293685 2:236845708-236845730 TGCCCCAACTCAGAAGGAGCGGG + Intergenic
1170494860 20:16914922-16914944 CCCACCAACTTGGAAGGAGCAGG - Intergenic
1170612528 20:17926284-17926306 CACCCCAACTCCTGAGGGGCAGG + Intergenic
1171536606 20:25898504-25898526 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1171804499 20:29662653-29662675 CATTCCAACTCAGAAGGGGCAGG + Intergenic
1174604799 20:51753365-51753387 CACTTGAACTCGGAAGGCGGAGG + Intronic
1174654802 20:52162212-52162234 CACTTGAACTCGGAAGGCGGAGG + Intronic
1175064302 20:56272358-56272380 CCCACCAACTCAGAAGGGGCAGG - Intergenic
1175675758 20:60945542-60945564 CACCCCAACTCAGAAGGGATGGG - Intergenic
1176790230 21:13311254-13311276 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1177592220 21:23185402-23185424 CACCACAACTGGGAATGTGCTGG - Intergenic
1177989403 21:28019463-28019485 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1178312703 21:31542882-31542904 CACTCAAACTCGGGAGGCGGAGG + Intronic
1178877036 21:36421568-36421590 CACCTGAACTCGGAGGGCGGAGG - Intergenic
1181025385 22:20124601-20124623 CACCCCAACTCCCCAGGCACAGG - Intronic
1181098027 22:20519536-20519558 CACTTGAACTCGGAAGGCGGAGG - Intronic
1183108158 22:35629331-35629353 CACCTGAACTCGGGAGGCGGAGG + Intronic
1184054528 22:42035451-42035473 CACCCCAACTTGGAAGGGGCGGG + Intronic
1184613493 22:45622016-45622038 CGTCCCAACTCAGAAGGGGCAGG - Intergenic
954651031 3:52162748-52162770 CACCCCAACTCAGAAGAAGCGGG + Intergenic
956222970 3:66923610-66923632 CACCCCAGCTGGGAATGTGCTGG - Intergenic
956817325 3:72920216-72920238 CACATCAACTCGGAAGGCGGAGG - Intronic
959863818 3:111243452-111243474 CACCCCAACTTGGAAGGGGCAGG + Intronic
960634400 3:119768771-119768793 CACCCCAACTCAGAAGGGGCGGG + Intergenic
962105405 3:132383680-132383702 CACCCCAACTCAGAAGGGGCAGG + Intergenic
962492480 3:135907881-135907903 CACCCCAAATGTGAAGGGGCAGG - Intergenic
965005562 3:163018830-163018852 CTCTCCAACTCAGAAGGGGCAGG - Intergenic
965793248 3:172411544-172411566 CCCACCAACTTGGAAGGGGCAGG + Intergenic
966437470 3:179904799-179904821 GACCCCAACTCAGAAGGAGAAGG - Intronic
967650001 3:191974034-191974056 CACCCCAGCTTGGAAGGGGCGGG + Intergenic
968538845 4:1151932-1151954 CCACCCAACTCGGAAGGGGCAGG + Intergenic
968572019 4:1346970-1346992 CACCCCAGCCCAGGAGGCGCAGG - Intergenic
972158974 4:36199057-36199079 CTTACCAACTCGGAAGGGGCAGG + Intronic
976675579 4:87698214-87698236 CCCACCAACTCGGAAGGGGCAGG + Intergenic
978977540 4:114896538-114896560 CACTCCAACTCAGGAGGCGGAGG + Intronic
980682897 4:136187253-136187275 CACCACAACTGGGAATGTGCTGG - Intergenic
980703027 4:136457269-136457291 CCCACCAACTCAGAAGGAGCAGG - Intergenic
980750229 4:137077638-137077660 CACCCCAACTCAGAAGGGGCGGG + Intergenic
980971394 4:139570435-139570457 CACCCCAACCCGGGAGGCAGAGG + Intronic
981314815 4:143331822-143331844 CACTCGAACTCGGAAGGCAGAGG - Intergenic
981573278 4:146176113-146176135 GACGCCAACTCGGTAGGAGCCGG - Exonic
982177367 4:152718614-152718636 AAACCGAACTCGGAAGGCGATGG - Intronic
983493112 4:168412147-168412169 CACCACAGCTAGGAAGGTGCTGG - Intronic
983775724 4:171604773-171604795 CACTCGAACCCGGAAGGCGGAGG - Intergenic
988771537 5:34437719-34437741 CACTCGAACTCGGGAGGCGGAGG + Intergenic
988940287 5:36139024-36139046 CCCGCCAACTCGGAAGGGGGTGG - Intronic
989100978 5:37822524-37822546 CACCGCACCTCGGCAGCCGCAGG - Intronic
989250290 5:39306077-39306099 CACTTGAACTCGGAAGGCGGAGG + Intronic
990828030 5:59923435-59923457 CACCACCACTGGGATGGCGCTGG - Intronic
993138346 5:83998500-83998522 CACCACAACTGGGAATGTGCTGG - Intronic
993234506 5:85286295-85286317 GAACCCAACCCGGAAGGCGGAGG + Intergenic
993267447 5:85744308-85744330 CACCACAACTGGGAATGTGCTGG + Intergenic
993646703 5:90472051-90472073 TACCCCATCTCGGAAAGAGCTGG - Intronic
995146913 5:108796957-108796979 CACCACAACTGGGAATGTGCTGG + Intronic
997611759 5:135220536-135220558 CACCTCAACACAGAAGGGGCTGG - Intronic
998291204 5:140916374-140916396 CACCACAACTAGGAATGTGCTGG + Intronic
1004369690 6:15041258-15041280 CGCTTGAACTCGGAAGGCGCAGG - Intergenic
1004520673 6:16358643-16358665 CATCCCAACTCGGAATGAACAGG - Intronic
1006467293 6:34203190-34203212 GCCCCCAACTCAGAAGGGGCGGG + Intergenic
1006500828 6:34457895-34457917 CCCACCAACTCGGAAGGGGCGGG - Intergenic
1006693774 6:35913408-35913430 CACTCCAACTCGGGAGGTGGAGG + Intronic
1006753655 6:36396294-36396316 TGCCCCAACTCAGAAGGGGCTGG - Intronic
1008848521 6:55996551-55996573 CACCACAACTTGGAATGTGCTGG + Intergenic
1012889817 6:104885517-104885539 CCCACCAACTCGGAAGGGGTAGG - Intergenic
1013086850 6:106864311-106864333 CCCACCAACTCGGAAGTGGCAGG + Intergenic
1013692889 6:112667178-112667200 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1013709460 6:112880084-112880106 CCCATCAACTCGGAAGGGGCGGG + Intergenic
1014289193 6:119539332-119539354 CACCCCAATTCAGAAGAGGCAGG - Intergenic
1015663567 6:135603011-135603033 TGCCCCAACTCAGAAGGGGCAGG - Intergenic
1016190569 6:141260636-141260658 CACCCCAACTCGGAAGGAACAGG - Intergenic
1016339764 6:143049852-143049874 TCCACCAACTCGGAAGGGGCAGG + Intergenic
1016940278 6:149477598-149477620 CACCCCAACACTGAAGGAGAGGG - Intronic
1019186074 6:170221059-170221081 CCCACCTACTCGGAAGGCGGAGG - Intergenic
1020568185 7:9823093-9823115 TGCCCCAACTCGGAAGTGGCGGG + Intergenic
1021561560 7:21972688-21972710 CCTCCCAACTCAGAAGGGGCAGG + Intergenic
1021999037 7:26207600-26207622 CGCCTCAACTCGGAAGGCAGAGG - Intronic
1022334333 7:29408104-29408126 CACCCGAACTCAGAAGGCGGAGG + Intronic
1023598977 7:41862951-41862973 CACTCGAACTCGGGAGGCGGAGG - Intergenic
1025288078 7:57685212-57685234 CATTCCAACTCGGAAGGGGCAGG - Intergenic
1028233178 7:88330009-88330031 CATCCCAATTCAGAAGGGGCAGG - Intergenic
1028817008 7:95157495-95157517 CACCCCACCTCAGAAGGAGAAGG + Intronic
1029973930 7:104815172-104815194 CACCCCAACTTAGAAGGGGTGGG + Intronic
1030620053 7:111779479-111779501 CACTTGAACTCGGAAGGCGGAGG - Intronic
1033551351 7:142451101-142451123 CAGCCCCAATGGGAAGGCGCTGG - Intergenic
1035450883 7:158976246-158976268 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1035535611 8:388866-388888 CACCTGAACCCGGAAGGCGGAGG - Intergenic
1035721950 8:1798914-1798936 CAGCCCAGCTCGGAGGGCCCAGG - Intergenic
1040298069 8:46173555-46173577 CAGCCCAACTGGGAAAGCCCTGG - Intergenic
1040485731 8:47869582-47869604 CACCACAACTGGGAATGTGCTGG - Intronic
1042395927 8:68292392-68292414 CATCCCAACTGAGAAGGGGCGGG - Intergenic
1043421630 8:80104242-80104264 CCCCCAAACTGGGAAGGAGCTGG - Intronic
1044461051 8:92444407-92444429 CACACCTACTCGGGAGGCGGAGG - Intergenic
1044525104 8:93242277-93242299 CACCCCAACTTGGAATGGGCAGG + Intergenic
1048073597 8:131044087-131044109 CACCTCAACTCGGGAGGCAGAGG + Intergenic
1049152615 8:141045062-141045084 CACCTGAACTCGGGAGGCGGAGG + Intergenic
1049305033 8:141898190-141898212 CACCCCAACAAAGAAGGCTCTGG + Intergenic
1049730740 8:144176743-144176765 CACTTGAACTCGGAAGGCGGAGG + Intronic
1049823861 8:144654652-144654674 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
1050103836 9:2145217-2145239 CATCCAAACTCGGGAGGCGGAGG + Intronic
1050130373 9:2406384-2406406 CACCCCAACTTGGAAGGGGCGGG - Intergenic
1050600771 9:7248027-7248049 CACTTGAACTCGGAAGGCGGAGG + Intergenic
1051001677 9:12290414-12290436 CACCCCAATTCAGAAGGGGTGGG - Intergenic
1051780553 9:20684328-20684350 CACCCCTGCTCGGGAGCCGCCGG + Intronic
1053076452 9:35138663-35138685 CATCCCAACTCAGAAGGGGCAGG - Intergenic
1053617241 9:39781236-39781258 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1053875423 9:42540601-42540623 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1053897219 9:42754034-42754056 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054236277 9:62561123-62561145 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1054266925 9:62926201-62926223 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054550418 9:66595655-66595677 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1056740790 9:89253167-89253189 CACAGCAACTTGGAAGGTGCCGG - Intergenic
1056985990 9:91364181-91364203 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1057548363 9:96034682-96034704 CACCCAAACTCAGAAGGGGCAGG - Intergenic
1058091760 9:100813784-100813806 CACCCCAGCTCAGAAGAGGCAGG + Intergenic
1058510585 9:105713069-105713091 CCCACCAACTTGGAAGGGGCAGG - Intronic
1059565391 9:115379480-115379502 CATCCCAATTCAGAAGGGGCAGG - Intronic
1060715688 9:125926434-125926456 CACTCAAACTCAGAAGGCGGAGG + Intronic
1061588060 9:131581024-131581046 CATCCCAACTCGGGAGGCTGAGG + Intronic
1186747547 X:12585002-12585024 CACTTGAACTCGGAAGGCGGAGG - Intronic
1189856574 X:45229932-45229954 CACCTCAACTTGGAAGGGGCAGG + Intergenic
1190122355 X:47672524-47672546 CACCACAACTGGGAATGTGCTGG + Intergenic
1192994494 X:76498593-76498615 CACCACAACCCAGAAGGCTCTGG - Intergenic
1193305785 X:79949688-79949710 CACCACAGCTGGGAAAGCGCTGG - Intergenic
1194205221 X:91003295-91003317 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1194380139 X:93181213-93181235 CACCTCAACTCAGAAGGGGCAGG - Intergenic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1199173690 X:144759412-144759434 CACCACAACTAGGATGGTGCTGG - Intergenic
1199614603 X:149647090-149647112 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1199861233 X:151801729-151801751 CACTCCAACTCAGAAGGGACAGG + Intergenic
1199969511 X:152849116-152849138 CACCCCAACTGGGAGGGAGGTGG + Intronic
1200551040 Y:4578432-4578454 CTTCCCAACTCAGAAGGGGCAGG + Intergenic