ID: 915798868

View in Genome Browser
Species Human (GRCh38)
Location 1:158766868-158766890
Sequence GTCTGAAGGAGGCTGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915798868_915798874 26 Left 915798868 1:158766868-158766890 CCTGTCAACAGCCTCCTTCAGAC 0: 1
1: 0
2: 2
3: 13
4: 155
Right 915798874 1:158766917-158766939 TGATTAACACAGCTCATTTTTGG 0: 1
1: 0
2: 1
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915798868 Original CRISPR GTCTGAAGGAGGCTGTTGAC AGG (reversed) Intergenic
900269064 1:1778056-1778078 GTCTGAGGGAGGCCGCTGTCCGG - Intronic
902650063 1:17831254-17831276 GGATGAAGGTGGTTGTTGACAGG + Intergenic
904517609 1:31068463-31068485 GGCTGAAGCAGGCTGATGACTGG + Intergenic
904521536 1:31099785-31099807 GTCAGAAGCAGGCTGTTGGAGGG + Intergenic
906809793 1:48814159-48814181 GTCCCAAGGAGGAGGTTGACAGG - Intronic
907325676 1:53637325-53637347 GTCTGAAGGAGGGTGATGACGGG + Intronic
915267869 1:154731724-154731746 GTGTGAGGGGGGCTGTGGACGGG + Intronic
915798868 1:158766868-158766890 GTCTGAAGGAGGCTGTTGACAGG - Intergenic
916617628 1:166458908-166458930 GGTTGAAGATGGCTGTTGACTGG - Intergenic
918139856 1:181711082-181711104 GGCTGCAGGAGGCTGGTGAGTGG + Intronic
922461036 1:225814600-225814622 GGCTGTGGGAGGCTGGTGACCGG + Intronic
922806617 1:228393585-228393607 GCCCCAGGGAGGCTGTTGACGGG - Intergenic
1063379549 10:5575796-5575818 CTCCGAGGGAGGCTCTTGACAGG + Intergenic
1067360510 10:45574042-45574064 GTGTGAAGGAGGCTTTGAACTGG - Intronic
1071256420 10:83875873-83875895 GTCTCTAGGTGGCTGTTGAAAGG + Intergenic
1074652952 10:115545789-115545811 TTCTGAAAGAAACTGTTGACAGG + Intronic
1077867987 11:6239097-6239119 GCCTGAAGGAGGCTGCTGTTGGG - Exonic
1078435343 11:11320541-11320563 CTCAGAAGGAGACTGTGGACAGG - Intronic
1079028524 11:16967849-16967871 GTCTGAAGTTGGCTGGTGAGGGG - Intronic
1080677098 11:34438637-34438659 GCCTGAAGGATGCTGATAACCGG + Intergenic
1080774531 11:35373285-35373307 GTCTGAAAGAAGGTGTTGAATGG - Intronic
1084939210 11:72603335-72603357 GTTGGAAGGAGGATGTTGAAAGG + Intronic
1086944412 11:92830992-92831014 TGCTGTAGGAGGCTGCTGACTGG + Intronic
1088626634 11:111734570-111734592 GTCAGACGTAGGCTGGTGACAGG - Intronic
1088653528 11:111977852-111977874 GGCTGGAGGATGCTGTTGGCCGG + Intronic
1088835399 11:113574392-113574414 GTCTGAAGGGGGCTGCTCCCAGG - Intergenic
1091277503 11:134362471-134362493 GTGTGGGAGAGGCTGTTGACAGG + Intronic
1091913671 12:4251937-4251959 CTCTGGAGGAGGCTGCAGACTGG - Intergenic
1092584125 12:9878824-9878846 GCCTGGAGGAGGCTGTAGAAAGG - Intergenic
1101205812 12:102486238-102486260 GTGTGAAGGAGGCTACTGACGGG - Intergenic
1102687675 12:114736933-114736955 GTCTGAAGGCGGCTGCTGAAAGG - Intergenic
1103722501 12:122982240-122982262 GCCTGGAGGAGGCTCTTGAAAGG + Intronic
1104735626 12:131134288-131134310 ATCTGAAGGAGGCTCTAGGCAGG - Intronic
1105065581 12:133194615-133194637 GTCTGAGGGAGGCTCTGGAAAGG + Intronic
1105257831 13:18756437-18756459 ATCTGAAGGAGGCTTCTGCCTGG - Intergenic
1105260491 13:18775746-18775768 ATCTGAAGGAGGCTTCTGCCTGG - Intergenic
1106498667 13:30306981-30307003 GTCTTGAGGGGGCTGTTGAGTGG - Intronic
1107813136 13:44219190-44219212 GTTTGAAGGGGGCAGTTGAGAGG + Intergenic
1109968714 13:69737361-69737383 GTGGGAAGGAGGCTGATGCCAGG + Intronic
1115426082 14:33261024-33261046 GTATGAAGCAGGCTGATGACAGG - Intronic
1121005792 14:90489813-90489835 GTTGGAAGGAGGCTGTTGAGTGG + Intergenic
1122280088 14:100616877-100616899 GTCTGGGGGAAGCTTTTGACTGG + Intergenic
1124721297 15:32113160-32113182 GTCTGAATGAAGGTGTTGTCAGG + Intronic
1125061067 15:35424946-35424968 GTCTGAAGGAGGCTGTAATCAGG - Intronic
1125545717 15:40502889-40502911 ATATGAAGGAGGCTGTAGTCTGG + Intergenic
1126142820 15:45451531-45451553 GGCTGAAGCAGGGAGTTGACAGG + Intergenic
1128336362 15:66788244-66788266 GTTTGGAGGAGGCTGTTGGGGGG + Intergenic
1131507569 15:93031090-93031112 GGATGAAGGAGGCTGGGGACGGG - Intergenic
1131717200 15:95125014-95125036 GTCTGAAGGAGACGGTTGTAAGG - Intergenic
1132942048 16:2513346-2513368 GTCTGGAGGAGACTGGGGACAGG + Intronic
1133187724 16:4112172-4112194 GTCTGAAGGTGTCAGTGGACGGG - Intronic
1134214142 16:12303127-12303149 GTCTGTTGCAGGCTGTAGACTGG + Intronic
1136794060 16:32998406-32998428 GTGAGATGGAGTCTGTTGACAGG + Intergenic
1136875851 16:33855973-33855995 GTGAGATGGAGTCTGTTGACAGG - Intergenic
1137486458 16:48895406-48895428 GTCTGATGGAGGATGTGGAGAGG - Intergenic
1137775135 16:51047940-51047962 GGCTGAGGGAGGCTGGAGACTGG + Intergenic
1138584281 16:57960329-57960351 GCCTGGAGCAGGCTGTTGGCGGG - Intronic
1141594133 16:85087171-85087193 GTCTGGGGGAGGCTGCTGGCAGG + Intronic
1143614650 17:8042606-8042628 GTGGGAAGGAGGCTGTTTCCTGG - Intronic
1143691281 17:8568232-8568254 GTCTGAAGCAAGGTGTTGGCAGG - Intronic
1144945044 17:18965509-18965531 GGCTGAAGGAGGCTGGGAACCGG - Intronic
1145958681 17:28872783-28872805 TTCTAAAGGTGGCTGTTGAGTGG + Intergenic
1147978154 17:44259584-44259606 GTGGGAAGGAGGGTGGTGACGGG + Intronic
1150256933 17:63754315-63754337 GTGTGAAGGAAGTTGGTGACAGG - Intronic
1150357210 17:64496910-64496932 GTCTGCAGGTGCCTGTTGTCTGG - Exonic
1152484365 17:80580392-80580414 GTCTGAGGGAGGCTTTTTCCTGG + Intronic
1153549150 18:6242517-6242539 GTTTGGAGGAAGCTGGTGACAGG - Intronic
1154185358 18:12178344-12178366 GTCTGCAGAGGGCTGGTGACCGG + Intergenic
1154425524 18:14269049-14269071 GTCTGAAGGAGGCTTCTGCCTGG + Intergenic
1154426444 18:14275635-14275657 CTCTGCAGGAGGCTACTGACTGG + Intergenic
1154428256 18:14288635-14288657 ATCTGAAGGAGGCTTCTGCCTGG + Intergenic
1154433221 18:14324290-14324312 ATCTGAAGGAGGCTTCTGCCTGG + Intergenic
1154434563 18:14333952-14333974 TTCTGCAGGAGGCTGCTGCCTGG + Intergenic
1157419114 18:47530773-47530795 GTCTGAACTAGGCTGATGAGTGG - Intergenic
1158620675 18:59029986-59030008 CTCTGCTGGAGGCTGCTGACAGG - Intergenic
1158785619 18:60708348-60708370 TTCTGAAGTAGGATGTTCACTGG + Intergenic
1160902352 19:1434785-1434807 GTAGGAAGGAGGCTGCTGGCTGG - Exonic
1162624989 19:11878232-11878254 CTCTGAAGGAAGCTTTGGACAGG - Intronic
1166565533 19:43763156-43763178 GGATGAAGGGGGCTGTTGGCTGG + Intergenic
1167637378 19:50662623-50662645 TTCTGAAACAGGCTGCTGACAGG + Exonic
1167673637 19:50871022-50871044 GTGGGGAGGAGGCTGTGGACTGG + Intronic
1168255266 19:55161473-55161495 GTCTGAGGGAGGCTGGTGTAGGG - Intronic
1168310931 19:55460426-55460448 GTCTGTAGGAGCCTTTTCACTGG + Intronic
1168433466 19:56299658-56299680 GTGTGCAGGAGGCTGTTCATAGG - Intronic
929933766 2:46278219-46278241 GTTGGAAGGAGGCTGGTGAAGGG - Intergenic
930096826 2:47571646-47571668 CGCTGAAGCAGGCTGCTGACAGG + Intergenic
931016092 2:57982426-57982448 GACTGAAGCAGGCTGTAGGCAGG + Intronic
933177681 2:79194340-79194362 CTCTTAAGGAGTCAGTTGACTGG + Intronic
937982420 2:127623395-127623417 GTATGAGGGAGGCGGCTGACGGG - Intronic
938701810 2:133886115-133886137 GTGTGGAGGAGGCTGGGGACAGG - Intergenic
941715127 2:168755726-168755748 GGCAGAAGGAGCCTGTTTACAGG - Intronic
942950553 2:181716273-181716295 GTCTGAATGGGGCTTATGACAGG + Intergenic
947371724 2:229453445-229453467 GTATGAACTAGACTGTTGACTGG + Intronic
1169931609 20:10839034-10839056 GTTTAAAGGAGGCTATTGTCTGG + Intergenic
1170584301 20:17722879-17722901 GTCTGGAGGAGGATGGGGACAGG + Intronic
1170821778 20:19760237-19760259 TTGGGAAGAAGGCTGTTGACAGG + Intergenic
1171883632 20:30635882-30635904 ATCTGAAGGAGGCTTCTGCCTGG - Intergenic
1172445945 20:34993477-34993499 GTGGGAAGGAGGCTGGGGACAGG + Intronic
1173741018 20:45401847-45401869 ATTTGAAGAATGCTGTTGACAGG - Intronic
1173947651 20:46964440-46964462 GTCCGCAGGTGGCTGTTGAAGGG + Intronic
1175467087 20:59196749-59196771 GTCTGGGGGAGAATGTTGACAGG - Intronic
1176112433 20:63416709-63416731 GGCTGATGGTGGCTGCTGACCGG - Intronic
1176846500 21:13880787-13880809 ATCTGAAGGAGGCTTCTGCCTGG - Intergenic
1181991395 22:26839552-26839574 GACTGATGGAGGCTGTTCATGGG + Intergenic
1183543446 22:38443139-38443161 CTCTGATGGAGGCTCTGGACTGG + Intronic
950764597 3:15264064-15264086 GGCTGATTGTGGCTGTTGACTGG - Intronic
952990801 3:38829294-38829316 GTGAGAAGGAGTCTGTTGTCAGG + Intergenic
954276241 3:49543548-49543570 GACTGGAGGATGCTGTTGAATGG - Intergenic
954771325 3:52971993-52972015 GTTTTAAGCAGGTTGTTGACAGG + Intronic
958764285 3:98346137-98346159 TTTTGAAGGAGGCTGCTGAGTGG - Intergenic
961702753 3:128759414-128759436 GTCTGAGGGAGGCTGTGCACTGG + Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
971074385 4:23130882-23130904 GTGTGAAGGAGGTTGTTTCCTGG - Intergenic
973367287 4:49218152-49218174 ATCTGAAGGAGGCTTCTGCCTGG - Intergenic
974751452 4:66146448-66146470 GTCTGAAGTTCGCTGTTGAATGG + Intergenic
975616123 4:76249518-76249540 TTCTGAAGGAGGCATTTTACCGG - Intronic
976870567 4:89788449-89788471 GTCTGAGCAAGGCTGCTGACAGG - Intronic
983524175 4:168743667-168743689 GTTTGAATGAGGTTGATGACTGG + Intronic
984705400 4:182844056-182844078 GCCTGATGGAGGCTGTGGCCTGG + Intergenic
987965622 5:24868473-24868495 GTCTGAAGGTAACTGTTGAATGG + Intergenic
989326819 5:40206213-40206235 GTCTGAAGGAAGCTGTGGGTTGG - Intergenic
990450786 5:55929977-55929999 GTCTGAAGGGGGCTGAGGCCAGG - Intergenic
990886695 5:60602442-60602464 CTCAGAAGGAGGCAGTTCACTGG + Intronic
991973718 5:72165500-72165522 GTCCGAAGGAGTCTGTGGCCAGG + Intronic
997777604 5:136625046-136625068 GCCTGAGGGAGGCTGCTGATAGG - Intergenic
997886034 5:137630620-137630642 GTCTGAAAGAGGTTTATGACGGG + Intronic
998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG + Intronic
1000747783 5:165056466-165056488 GTGAGAAGGTGGCTGTTGACAGG - Intergenic
1001801517 5:174548336-174548358 ATCAGAAAGAGGCTGTTGGCTGG + Intergenic
1002343936 5:178535268-178535290 GTCAGAAGGAAGCTGTGGGCTGG - Intronic
1003049850 6:2770064-2770086 TTCTGCAGGTGGCTGTTGACTGG + Intronic
1003314910 6:5003628-5003650 GTCTGGAGGGAGCTGTTGTCAGG - Intronic
1006788407 6:36683048-36683070 GTCTGAAGGAGGTAGTTGGCAGG + Intronic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1007998592 6:46335069-46335091 GTCTGAAGGAGGCCCTTAGCTGG + Intronic
1008136900 6:47787587-47787609 TTTTAAAGGAGGCTTTTGACGGG - Intronic
1010756640 6:79672996-79673018 TTCTGAAGAAGGCTGCTGAGGGG + Intronic
1010841200 6:80650639-80650661 ATGTGAAGGAGGCTTTGGACTGG + Intergenic
1014810229 6:125877299-125877321 GGCTGAAGGAAGATGTGGACTGG - Intronic
1017497034 6:154992365-154992387 GTATGAAGAAAGCTGTTCACAGG - Intronic
1018653938 6:166014265-166014287 GACTAAAGGATGCTGTTGTCAGG + Intergenic
1019073816 6:169370850-169370872 GTCTAAGGGAGGCTGTGGAGGGG - Intergenic
1019860343 7:3652929-3652951 GACTGCAGGAGTCTATTGACTGG + Intronic
1020593907 7:10180147-10180169 GTACGTAGGTGGCTGTTGACTGG - Intergenic
1024272068 7:47650187-47650209 GTCTGAGAGAGGCTGCTGTCGGG - Intergenic
1025611407 7:63078120-63078142 GGCTAAAGGAGGCTGATGAGGGG - Intergenic
1031134353 7:117870004-117870026 GACTGAAGGAGGATTTGGACCGG - Intronic
1033541308 7:142358415-142358437 CTCTCATGGAGGCTGTTGCCTGG - Intergenic
1033571795 7:142636834-142636856 GTCACAAGGAGGTTGCTGACGGG + Intergenic
1039090348 8:33821472-33821494 GACTGAAGGAGGCAGAAGACTGG - Intergenic
1039705040 8:39997948-39997970 GTATGAAGCCGGCTGGTGACTGG + Intronic
1041114748 8:54524571-54524593 GTATGAGGGAGGCTGTTGTGAGG + Intergenic
1046075009 8:109303646-109303668 ATGTGAAGGAGGCTTTTAACTGG - Intronic
1046353360 8:113046141-113046163 GTCTGAAGGAGGCCGCTGACTGG - Intronic
1050363804 9:4855597-4855619 TTCTTAAGGAGGCTGTTTGCTGG + Intronic
1051530123 9:18092942-18092964 AGCTGAACAAGGCTGTTGACAGG + Intergenic
1053662812 9:40296198-40296220 GTCTGCAGCAGGCTGCTGCCTGG + Intronic
1053913259 9:42926373-42926395 GTCTGCAGCAGGCTGCTGCCTGG + Intergenic
1054374941 9:64442422-64442444 GTCTGCAGCAGGCTGCTGCCTGG + Intergenic
1054521801 9:66080086-66080108 GTCTGCAGCAGGCTGCTGCCTGG - Intergenic
1056725757 9:89114540-89114562 GTATAAAGGAGGCTGTGCACAGG + Intronic
1057294917 9:93829340-93829362 GTCTAACGGGGGCTCTTGACAGG + Intergenic
1057348554 9:94274939-94274961 ATCTGAAGTAGGGTTTTGACTGG + Intronic
1061762557 9:132860522-132860544 GCCTGAAGGAGGCTGCTGCTGGG + Intronic
1186487529 X:9945023-9945045 GTCTGCAGGAGGAGGTGGACAGG - Intronic
1188419598 X:29978176-29978198 ATGTGAAGGAGGCTTTGGACTGG - Intergenic
1189200479 X:39191515-39191537 GTTTTAAGGAGGCTGTTGCCAGG + Intergenic
1196178872 X:112668883-112668905 ATCTGATGGAGGCTGTTGCTAGG + Intronic
1196771714 X:119301192-119301214 ACCTGAAGGGGGCTGTTGAGTGG + Intergenic
1198711025 X:139504615-139504637 GGGTAAAGGAGGCTGTAGACTGG + Intergenic
1200250020 X:154547724-154547746 GTCTGACGGACTCTGCTGACAGG + Intronic