ID: 915799770

View in Genome Browser
Species Human (GRCh38)
Location 1:158777762-158777784
Sequence CAGTAATAGTAATAGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915799770 Original CRISPR CAGTAATAGTAATAGTAGTG AGG (reversed) Intergenic
905502316 1:38449519-38449541 CAGAATGAGTAATAGTAATGGGG + Intergenic
907064044 1:51461806-51461828 CAGTAGTAGTAATAATATGGTGG + Intronic
908381206 1:63598577-63598599 CAGTAGTAGTAATAATACTGTGG + Intronic
909991825 1:82232991-82233013 CCATAATAGTAATAGTATTATGG - Intergenic
910133279 1:83934908-83934930 CAGTAACAATAATAGTACTCTGG - Intronic
910559982 1:88579667-88579689 CAGTAATAGTCATGGTAGCTGGG - Intergenic
915799770 1:158777762-158777784 CAGTAATAGTAATAGTAGTGAGG - Intergenic
916236176 1:162591227-162591249 CAGTACTATTAACAGTAGTGAGG - Intronic
916832126 1:168503825-168503847 CAATGATGGTAATAGTAGTGAGG - Intergenic
918817160 1:189202372-189202394 CTGTAATAATAAAAGTATTGTGG + Intergenic
919197451 1:194306031-194306053 TAGTGGTAGTAGTAGTAGTGAGG + Intergenic
920417467 1:205808450-205808472 GGATAATAGTAATGGTAGTGGGG - Intronic
920794737 1:209128267-209128289 CACTTAGAGTAACAGTAGTGTGG - Intergenic
922028646 1:221777552-221777574 CAGTACTAGTAATTGTACTCTGG + Intergenic
1068375530 10:56174861-56174883 CTGTAATATTAATAAAAGTGAGG + Intergenic
1068819589 10:61358773-61358795 CAATAATAATAATAGAAGTAGGG - Intergenic
1069218579 10:65853982-65854004 TAGAAATAGTAATAGTAGGCTGG - Intergenic
1070145092 10:73768081-73768103 CATTAATAGAAATAGTGTTGGGG + Intronic
1071068910 10:81669304-81669326 CAGTATCAATAATAGTAGTAAGG + Intergenic
1071080431 10:81803726-81803748 CAGAAATAGTAAAAGTACTTGGG + Intergenic
1071109411 10:82137389-82137411 CAGTTAAAATAATAGTATTGTGG - Intronic
1072398385 10:95069285-95069307 CAATAATAGGAAGAGGAGTGGGG + Exonic
1073188576 10:101633114-101633136 CAGAAATAGTAATAGTACCTAGG + Intronic
1074084785 10:110201386-110201408 CAGAAATAGTCATAAAAGTGAGG - Intergenic
1075177640 10:120180830-120180852 CAATAATAATAATAGTAGACTGG - Intergenic
1079042770 11:17074025-17074047 CAGAAATAGTAATATTAGGTTGG - Intergenic
1080126636 11:28742658-28742680 CAGTAAAAGTTATAGTAATTGGG - Intergenic
1085117210 11:73940111-73940133 CAGTAGTAGTAACAGCAGTGAGG + Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085376489 11:76067211-76067233 AAGTAACAGTAAAAGTAGTATGG - Intronic
1085716083 11:78874820-78874842 CAGTATCATTAATTGTAGTGTGG - Intronic
1086371857 11:86163061-86163083 CAGTAATAGTAATGGTAATGTGG + Intergenic
1087613438 11:100461523-100461545 CAGTCATAGTAACAGTGGAGTGG - Intergenic
1088172089 11:107009746-107009768 CAGTAAAGGTAATAGTTGTCTGG + Intronic
1089087590 11:115836418-115836440 AAGAAAGAGTAATAGGAGTGAGG + Intergenic
1090344045 11:126053108-126053130 CAGTAATAAGAATTATAGTGAGG - Intronic
1090591647 11:128277193-128277215 CAGTAATACTTAAAGTAGTATGG - Intergenic
1093887784 12:24482453-24482475 GGGTAATAGTGATAGTAGTGGGG - Intergenic
1095292645 12:40493152-40493174 CATTAATTGTAATACTATTGAGG - Intronic
1101867869 12:108535562-108535584 CTGTAACACTAATAGTTGTGGGG - Intronic
1102131615 12:110534720-110534742 CAGTGATACTGAAAGTAGTGGGG - Exonic
1106192516 13:27466164-27466186 CAATAATAATAATACTAATGTGG - Intergenic
1107369273 13:39725217-39725239 TAGTAATAGTAATAATAATATGG + Intronic
1108968846 13:56346330-56346352 CAGTAATAGAAAATGAAGTGGGG - Intergenic
1111065385 13:83084792-83084814 CAGACATAGTAAGAGTAGTAAGG - Intergenic
1113035554 13:106044133-106044155 CAGTAACACTAAGATTAGTGCGG - Intergenic
1114138908 14:19889375-19889397 AAATAATAATAATAATAGTGGGG - Intergenic
1115518558 14:34209775-34209797 TAGTAGTAGTGGTAGTAGTGGGG + Intronic
1116007295 14:39307915-39307937 TAGTAATAGTAATATGAGGGTGG + Intronic
1116620444 14:47196291-47196313 CTGTAGTAGTAATAGTAAAGAGG + Intronic
1116773228 14:49150920-49150942 CAGCAATAGCAATAGCAGTTGGG - Intergenic
1117263226 14:54058376-54058398 AAATAATAGTAATAATACTGAGG - Intergenic
1120393031 14:83931840-83931862 CAGAAATAGAAATTGTACTGAGG - Intergenic
1120555298 14:85922501-85922523 CTGTAATAGTCATGGAAGTGAGG + Intergenic
1121513522 14:94533325-94533347 AAATATTAGTTATAGTAGTGTGG - Intergenic
1127976362 15:64000162-64000184 TAGTAGTAGTAGTAGTAGTCAGG - Intronic
1128424198 15:67522436-67522458 ATGTAATAGTATTAGTAGTACGG - Intronic
1128733898 15:70040086-70040108 TAGTAATAGTAATAGTTGTTTGG + Intergenic
1129778847 15:78255752-78255774 GATTAGTAGTGATAGTAGTGAGG + Intergenic
1133397530 16:5460297-5460319 CAGGAATAGTAATAATCTTGTGG + Intergenic
1133682386 16:8132017-8132039 TAATAATAATAATAGTAGTGAGG - Intergenic
1135747952 16:25033153-25033175 CAATAATAATAATAGTAATGTGG + Intergenic
1137803708 16:51284551-51284573 CATGAATAGTAATAGTGGTAGGG + Intergenic
1138668687 16:58595310-58595332 TAGTGACAGTAATAGTGGTGCGG - Intronic
1141112249 16:81279439-81279461 AAGTGATAGTAGTAGTAGTATGG + Intronic
1143905586 17:10206563-10206585 TAATAATAGTAATAGTATTCTGG + Intergenic
1146148847 17:30448725-30448747 CAGTAAAAGTAATTTGAGTGGGG - Intronic
1146410820 17:32582873-32582895 AAATAATAGTAAAAGTAATGTGG - Intronic
1146672404 17:34750555-34750577 CAGCAATAGCAGTAGTAGTAGGG - Intergenic
1151011774 17:70506785-70506807 CAGTAATGTTTATAGAAGTGGGG + Intergenic
1151634683 17:75337860-75337882 TAGTAGTAGTAATAGTAGGCCGG - Intronic
1153546314 18:6209247-6209269 TAGAAGTAGTAATAGTAGAGTGG - Intronic
1156554659 18:38053569-38053591 CAGTAATAGTAATAGGACCAAGG + Intergenic
1157078886 18:44499558-44499580 CAATAGTAGTAATAGTGGAGAGG - Intergenic
1158199790 18:54926951-54926973 CAGTAATGGTAATAGAAATATGG + Intronic
1158956597 18:62546223-62546245 CAGTCATGGTAACAGTCGTGAGG + Intronic
1163361583 19:16850162-16850184 TAGTAGTAGTAGTAGTATTGTGG + Intronic
1164848893 19:31462744-31462766 TATTAATAATAATAATAGTGGGG - Intergenic
1166039953 19:40195910-40195932 CAGTCATAATAATAATAGTAAGG - Intronic
925395471 2:3530255-3530277 GAGTATTAGTAGTAGTAGTATGG + Intergenic
925395501 2:3530471-3530493 GAGTATTAGTAGTAGTAGTACGG + Intergenic
925395505 2:3530508-3530530 GAGTATTAGTAGTAGTAGTATGG + Intergenic
928737713 2:34311343-34311365 TGGTAATAGTAACAGTAGTAAGG - Intergenic
928738688 2:34323785-34323807 GAGTAATAGAAATAGTAGCAAGG - Intergenic
928995005 2:37279852-37279874 CATAAATAGTGATAGTAGTCGGG - Exonic
929632518 2:43479203-43479225 TAGCAACAGTAATAGTAGTTTGG - Intronic
930287947 2:49457367-49457389 TAGTAGTAGTAGTAGTAGTAGGG - Intergenic
931890252 2:66663440-66663462 CAGTGATAGGAACAGTTGTGTGG - Intergenic
933043991 2:77509962-77509984 CTGTAAAAGTAATAGCAGAGAGG - Intronic
933104890 2:78311947-78311969 CAGTCATCGTAATGGGAGTGAGG + Intergenic
933453693 2:82493748-82493770 AAGTAATAGTAATTGCAGAGGGG - Intergenic
933815442 2:86064644-86064666 GAGTAATAGTAATATTTGTTGGG - Intronic
935722694 2:105993572-105993594 CAGTAGTAGTAACAGCAATGAGG - Intergenic
935886667 2:107627733-107627755 TAGTAATAATAATAATAGTCCGG - Intergenic
935942162 2:108251464-108251486 CAGTAGTATCACTAGTAGTGAGG + Intronic
936832349 2:116662970-116662992 CAGAAATAGTATTACTAGTTGGG + Intergenic
937581798 2:123496889-123496911 ATGTAATAGTAATAGTATTTGGG - Intergenic
938732713 2:134158755-134158777 CAGTAGTAGTGATGGCAGTGGGG - Intronic
938914492 2:135922581-135922603 AAGTAATAGTAATAATAATATGG - Intronic
939481660 2:142755637-142755659 CTGTAGTAGTAATAGCAGGGTGG - Intergenic
939482091 2:142761908-142761930 CTGTAGTAGTAATAGCAGGGTGG - Intergenic
940622947 2:156136285-156136307 CAGAAAAAGTAAGAATAGTGAGG - Intergenic
941503933 2:166316335-166316357 AAGTAATAGTGATATTAGAGAGG + Intronic
942160657 2:173182885-173182907 CATTAACAGTAACAGAAGTGAGG + Exonic
948601414 2:239109376-239109398 CAGTAATAGGAACACAAGTGGGG - Intronic
1170319270 20:15077499-15077521 AAGGATTAGTATTAGTAGTGTGG + Intronic
1172159616 20:32857530-32857552 CAGTAATAATAAAACAAGTGGGG - Intergenic
1172671474 20:36637120-36637142 CTGTAATTGAAATAGAAGTGAGG + Intronic
1173029013 20:39337163-39337185 CAGTAATTGTAGTAGCTGTGTGG + Intergenic
1173065665 20:39708252-39708274 TAGTAGTAGTAGTAGTAGTAGGG + Intergenic
1175671486 20:60906924-60906946 CAGTGATGGTGATAGTGGTGAGG + Intergenic
1180176098 21:46090685-46090707 TAGTAGTAGTGACAGTAGTGGGG + Intergenic
1180176121 21:46090811-46090833 TAGTAGTAGTGACAGTAGTGGGG + Intergenic
950347775 3:12313970-12313992 CACTAATACTAAAATTAGTGAGG + Intronic
951015004 3:17721678-17721700 TAGTAATAATAATAATAATGTGG + Intronic
952897020 3:38084559-38084581 TAGTGGTAGTAGTAGTAGTGGGG + Intronic
957259067 3:77876918-77876940 GAATAATAATAATATTAGTGGGG - Intergenic
958112060 3:89161341-89161363 CATTAATAGTATTAGTTATGTGG + Intronic
959940957 3:112080524-112080546 TAGTAGTAGTAGTAGTAGTGAGG - Intronic
960441580 3:117695084-117695106 CAATTATAGTGATACTAGTGTGG - Intergenic
960709710 3:120515609-120515631 CAATATAAGTAATAGTAGAGAGG - Intergenic
963184151 3:142394129-142394151 CAGTAATAGTAGTAATAGTCTGG - Intronic
964329580 3:155587516-155587538 CAGTAATAGGAAGAGAAGCGTGG - Intronic
964536907 3:157732062-157732084 CAGTTTTAGTAATAGAAGTTTGG + Intergenic
965391446 3:168109354-168109376 CAGTAATAGTAATAGTTAGGTGG - Intergenic
965493068 3:169363608-169363630 CAGTAATAGAAATGGTGGAGAGG + Intronic
969602680 4:8186230-8186252 CATTAAAAGTAATGGGAGTGAGG + Intronic
971060929 4:22968637-22968659 TAGTAGTAGTAATAGCAGTAGGG - Intergenic
971778101 4:30994310-30994332 CAGAAATAGTCAGAGTATTGGGG - Intronic
974369502 4:60997051-60997073 CTGTAATATTTATAGAAGTGGGG + Intergenic
975610516 4:76198106-76198128 CAGTAATAGGAAGAGAAGTGCGG - Intronic
976239287 4:82936769-82936791 GAGTTATAGTAATAGTACTTTGG + Intronic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
980622137 4:135321228-135321250 CAGTACTAGGAACAGTACTGTGG - Intergenic
983225270 4:165080707-165080729 AAATAATAATAATAGTAATGTGG - Intronic
990247485 5:53877623-53877645 CAGTAAGTTTATTAGTAGTGAGG - Intergenic
990265037 5:54065976-54065998 AAGTAGTGGTAATAATAGTGCGG - Intronic
992245783 5:74820901-74820923 CAGAAATAGTAAGAGCAGTGTGG - Intronic
993436909 5:87908160-87908182 CATGAAAAGTAATAGTAGTGGGG - Intergenic
994549680 5:101215657-101215679 CATTTATAGTAATATTAGTGTGG - Intergenic
995480625 5:112588853-112588875 CAATAATAGTGTTAGTAGTGGGG + Intergenic
996392515 5:122976993-122977015 CAGTAATAAGAATGGTAATGTGG - Intronic
998604141 5:143616195-143616217 CAGAAATAGTACAAGGAGTGGGG - Intergenic
998779263 5:145638145-145638167 CAATAATAGTACTAGCAATGAGG - Intronic
999933742 5:156462627-156462649 TAGCAATAGAAATAATAGTGAGG + Intronic
1000182363 5:158823866-158823888 GGGTGATGGTAATAGTAGTGAGG - Intronic
1004049933 6:12066972-12066994 CAACAATAATAATAGTAATGTGG + Intronic
1006166000 6:32065303-32065325 CAGTCATTGTAAAAGTACTGAGG - Intronic
1007874423 6:45079535-45079557 CAGTAATATTATTTGAAGTGAGG - Intronic
1008545350 6:52578450-52578472 AAATAATAATAATAGCAGTGGGG - Intergenic
1013732884 6:113189872-113189894 TAGTAGTAGTAGCAGTAGTGAGG - Intergenic
1014466782 6:121765463-121765485 TGATAATAGTAATGGTAGTGGGG + Intergenic
1014906411 6:127034717-127034739 CAGTAATTATAATAGTAATGTGG - Intergenic
1015158267 6:130122930-130122952 TATTAATAGTAGTAGTATTGTGG + Intronic
1016203454 6:141442199-141442221 CAATAATACCAATAGCAGTGTGG - Intergenic
1016235617 6:141861207-141861229 CAAGAATAATAATAGAAGTGAGG + Intergenic
1018249146 6:161850824-161850846 CAGTAACAGTCATACTAATGTGG + Intronic
1018949327 6:168368944-168368966 CAGTAATGGACATAGGAGTGAGG + Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021151273 7:17153384-17153406 CAGTAATACCAATACTGGTGAGG - Intergenic
1022119766 7:27296822-27296844 CAGCAACAATAATAGTACTGTGG - Intergenic
1022408259 7:30113652-30113674 CAGTAATAGGGAGAATAGTGAGG - Intronic
1022659196 7:32350379-32350401 TAGTTATAATAATAGTATTGTGG - Intergenic
1022740859 7:33119983-33120005 CAATAATAATAATAATAATGAGG - Intergenic
1027919550 7:84375319-84375341 CAGAAAAAGTAATATTATTGAGG + Intronic
1028555759 7:92122709-92122731 TAGTAGTAGTAGTAGTAATGAGG - Intronic
1029836369 7:103316107-103316129 CAATAATATGAATAGTAGTAAGG + Intronic
1031139084 7:117921410-117921432 CAATAATAGTGATAATAGTGGGG + Intergenic
1041802888 8:61819205-61819227 CAGTTATAATAATAGTTGGGTGG - Intergenic
1043252844 8:78097344-78097366 CAGCAATAGTAAGAATAGAGTGG + Intergenic
1045822556 8:106357673-106357695 CATTAATACTAATAGTAATAGGG + Intronic
1046240031 8:111478072-111478094 TAGTAAAAGTAATAGAAGTTTGG - Intergenic
1046306159 8:112370085-112370107 TAGTAGTAGTAGTAGTAGTCAGG + Intronic
1048485400 8:134843380-134843402 TAGCAGTAGTAATAGTAGTAGGG - Intergenic
1048696177 8:137030865-137030887 CATTAGTTGTATTAGTAGTGAGG - Intergenic
1051431083 9:16981115-16981137 CAGGAGTTGTAAAAGTAGTGTGG - Intergenic
1051472938 9:17470015-17470037 TAGTAATAGCAGTAGTAGTATGG + Intronic
1051506271 9:17830981-17831003 CAGTAAGAGTAATTGTCTTGAGG + Intergenic
1054730422 9:68697410-68697432 CAGGAATAATAATTGTAATGAGG - Intergenic
1055242462 9:74200016-74200038 CAGTGAAAGGAATAGTAGAGAGG - Intergenic
1057827580 9:98382613-98382635 CAGTAATGGAAATGGTACTGGGG - Intronic
1058552631 9:106131783-106131805 CAGAGAAAGTAACAGTAGTGAGG + Intergenic
1058801536 9:108549268-108549290 CAGCAAAGGTAATAATAGTGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060713342 9:125892863-125892885 AAGTAATAATAATAGTAGCTTGG + Intronic
1186665654 X:11714255-11714277 CAATAATAGGAAGAGTAGTTGGG + Intergenic
1189310781 X:40015789-40015811 CATTAATAGTGACAGAAGTGAGG - Intergenic
1190546978 X:51537809-51537831 CAGTACTAGTACTAGTGGGGAGG + Intergenic
1190710661 X:53066721-53066743 TAGTAATAATAATAATAATGAGG - Intronic
1190935595 X:54996589-54996611 CAGAATTGGTAACAGTAGTGAGG - Intronic
1191706471 X:64099457-64099479 CAGTAGTAGCAAGAGAAGTGAGG + Intergenic
1196487978 X:116235988-116236010 TAGAAAGAGTAATAGTTGTGTGG - Intergenic
1196787529 X:119434020-119434042 TAGTAACAGTTGTAGTAGTGTGG + Intronic
1197865537 X:131012779-131012801 CACTATTAGTAATGGGAGTGAGG + Intergenic