ID: 915800910

View in Genome Browser
Species Human (GRCh38)
Location 1:158792426-158792448
Sequence CTAGGTAACAGCATGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915800910_915800912 21 Left 915800910 1:158792426-158792448 CCAGGCATCATGCTGTTACCTAG No data
Right 915800912 1:158792470-158792492 TATTATTTTATAAGCCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915800910 Original CRISPR CTAGGTAACAGCATGATGCC TGG (reversed) Intergenic
No off target data available for this crispr