ID: 915801430

View in Genome Browser
Species Human (GRCh38)
Location 1:158797070-158797092
Sequence GTTCAGTAGAACCTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915801430_915801436 30 Left 915801430 1:158797070-158797092 CCTACAGTGAGGTTCTACTGAAC No data
Right 915801436 1:158797123-158797145 TACAGAGAGTTTCCCAGGCTGGG No data
915801430_915801434 25 Left 915801430 1:158797070-158797092 CCTACAGTGAGGTTCTACTGAAC No data
Right 915801434 1:158797118-158797140 CAAGATACAGAGAGTTTCCCAGG No data
915801430_915801435 29 Left 915801430 1:158797070-158797092 CCTACAGTGAGGTTCTACTGAAC No data
Right 915801435 1:158797122-158797144 ATACAGAGAGTTTCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915801430 Original CRISPR GTTCAGTAGAACCTCACTGT AGG (reversed) Intergenic
No off target data available for this crispr