ID: 915801435

View in Genome Browser
Species Human (GRCh38)
Location 1:158797122-158797144
Sequence ATACAGAGAGTTTCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915801430_915801435 29 Left 915801430 1:158797070-158797092 CCTACAGTGAGGTTCTACTGAAC No data
Right 915801435 1:158797122-158797144 ATACAGAGAGTTTCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915801435 Original CRISPR ATACAGAGAGTTTCCCAGGC TGG Intergenic
No off target data available for this crispr