ID: 915801436

View in Genome Browser
Species Human (GRCh38)
Location 1:158797123-158797145
Sequence TACAGAGAGTTTCCCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915801432_915801436 -10 Left 915801432 1:158797110-158797132 CCTTCAGCCAAGATACAGAGAGT No data
Right 915801436 1:158797123-158797145 TACAGAGAGTTTCCCAGGCTGGG No data
915801430_915801436 30 Left 915801430 1:158797070-158797092 CCTACAGTGAGGTTCTACTGAAC No data
Right 915801436 1:158797123-158797145 TACAGAGAGTTTCCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915801436 Original CRISPR TACAGAGAGTTTCCCAGGCT GGG Intergenic
No off target data available for this crispr