ID: 915802055

View in Genome Browser
Species Human (GRCh38)
Location 1:158804188-158804210
Sequence GGATTGTGCTGCAACAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915802051_915802055 12 Left 915802051 1:158804153-158804175 CCTGAGAAGAGATTATGCCAGGT No data
Right 915802055 1:158804188-158804210 GGATTGTGCTGCAACAAAACAGG No data
915802053_915802055 -5 Left 915802053 1:158804170-158804192 CCAGGTCCTTGACTTTTAGGATT No data
Right 915802055 1:158804188-158804210 GGATTGTGCTGCAACAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915802055 Original CRISPR GGATTGTGCTGCAACAAAAC AGG Intergenic
No off target data available for this crispr